Incidental Mutation 'R7235:Kat6a'
ID562768
Institutional Source Beutler Lab
Gene Symbol Kat6a
Ensembl Gene ENSMUSG00000031540
Gene NameK(lysine) acetyltransferase 6A
SynonymsZfp220, MOZ, 9930021N24Rik, Myst3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7235 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location22859535-22943259 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 22914269 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 454 (D454G)
Ref Sequence ENSEMBL: ENSMUSP00000038181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044331] [ENSMUST00000110696]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044331
AA Change: D454G

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000038181
Gene: ENSMUSG00000031540
AA Change: D454G

DomainStartEndE-ValueType
H15 85 165 1.88e-5 SMART
low complexity region 184 195 N/A INTRINSIC
PHD 208 263 1.7e-7 SMART
RING 209 262 1.28e0 SMART
PHD 264 311 9.84e-13 SMART
RING 265 310 4.15e0 SMART
low complexity region 371 378 N/A INTRINSIC
Pfam:MOZ_SAS 561 748 5.9e-92 PFAM
low complexity region 787 800 N/A INTRINSIC
low complexity region 985 1003 N/A INTRINSIC
low complexity region 1011 1029 N/A INTRINSIC
low complexity region 1031 1044 N/A INTRINSIC
low complexity region 1066 1079 N/A INTRINSIC
low complexity region 1149 1162 N/A INTRINSIC
low complexity region 1224 1238 N/A INTRINSIC
low complexity region 1257 1273 N/A INTRINSIC
coiled coil region 1278 1308 N/A INTRINSIC
low complexity region 1397 1409 N/A INTRINSIC
low complexity region 1471 1490 N/A INTRINSIC
low complexity region 1528 1542 N/A INTRINSIC
low complexity region 1569 1597 N/A INTRINSIC
low complexity region 1641 1700 N/A INTRINSIC
low complexity region 1802 1813 N/A INTRINSIC
low complexity region 1950 1958 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110696
AA Change: D454G

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106324
Gene: ENSMUSG00000031540
AA Change: D454G

DomainStartEndE-ValueType
H15 85 165 1.88e-5 SMART
low complexity region 184 195 N/A INTRINSIC
PHD 208 263 1.7e-7 SMART
RING 209 262 1.28e0 SMART
PHD 264 311 9.84e-13 SMART
RING 265 310 4.15e0 SMART
low complexity region 371 378 N/A INTRINSIC
Pfam:MOZ_SAS 564 742 2.9e-85 PFAM
low complexity region 787 800 N/A INTRINSIC
low complexity region 985 1003 N/A INTRINSIC
low complexity region 1011 1029 N/A INTRINSIC
low complexity region 1031 1044 N/A INTRINSIC
low complexity region 1066 1079 N/A INTRINSIC
low complexity region 1149 1162 N/A INTRINSIC
low complexity region 1224 1238 N/A INTRINSIC
low complexity region 1257 1273 N/A INTRINSIC
coiled coil region 1278 1308 N/A INTRINSIC
low complexity region 1397 1409 N/A INTRINSIC
low complexity region 1471 1490 N/A INTRINSIC
low complexity region 1528 1542 N/A INTRINSIC
low complexity region 1569 1597 N/A INTRINSIC
low complexity region 1641 1700 N/A INTRINSIC
low complexity region 1802 1813 N/A INTRINSIC
low complexity region 1950 1958 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the MOZ, YBFR2, SAS2, TIP60 family of histone acetyltransferases. The protein is composed of a nuclear localization domain, a double C2H2 zinc finger domain that binds to acetylated histone tails, a histone acetyl-transferase domain, a glutamate/aspartate-rich region, and a serine- and methionine-rich transactivation domain. It is part of a complex that acetylates lysine-9 residues in histone 3, and in addition, it acts as a co-activator for several transcription factors. Allelic variants of this gene are associated with autosomal dominant mental retardation-32. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous null mice display perinatal lethality, cyanosis, decreased hematopoietic progenitor cell numbers, and severely impaired spleen and thymus development, but are not anemic. Heterozygotes display strain background dependent reductions in fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik T G 2: 85,500,219 H248P probably damaging Het
Ahnak T A 19: 9,012,488 M3712K unknown Het
Bri3bp A G 5: 125,441,684 E8G unknown Het
Brip1 C T 11: 86,138,875 R611Q possibly damaging Het
C330027C09Rik T A 16: 49,001,059 L176H probably damaging Het
Carm1 T G 9: 21,587,405 probably benign Het
Catsper4 A T 4: 134,212,581 probably null Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Clk4 A G 11: 51,276,185 D330G probably damaging Het
Dcdc2c A G 12: 28,470,719 S453P Het
Ddx46 G A 13: 55,663,240 V550I probably benign Het
Dennd1a T C 2: 37,801,061 N676D probably benign Het
Dnah3 T C 7: 120,032,670 N1365S probably damaging Het
Dsg1b T C 18: 20,399,423 V508A probably benign Het
Dus2 T C 8: 106,015,955 V39A possibly damaging Het
Dync1li1 T C 9: 114,715,163 V301A possibly damaging Het
Efcc1 T G 6: 87,753,798 S513A probably benign Het
Eif3f T C 7: 108,938,088 V167A possibly damaging Het
Ephb2 A G 4: 136,693,828 Y404H probably damaging Het
Eqtn A T 4: 94,923,699 D152E probably damaging Het
Ercc5 A C 1: 44,178,203 K902T possibly damaging Het
Erlec1 T A 11: 30,950,751 E139V possibly damaging Het
Evl G A 12: 108,648,460 G38R probably damaging Het
Foxd2 T C 4: 114,908,271 N184S unknown Het
Frem3 T C 8: 80,690,725 Y2020H probably benign Het
Ganc T C 2: 120,433,717 F384L probably damaging Het
Gm11756 G T 4: 73,917,571 L219M probably benign Het
Grin2a A G 16: 9,579,265 L986P probably damaging Het
Ift140 A T 17: 25,020,645 D92V possibly damaging Het
Inpp5b A G 4: 124,751,392 K158E probably benign Het
Iscu T A 5: 113,776,882 S152T probably benign Het
Isl2 C T 9: 55,544,171 T115I probably benign Het
Kalrn T A 16: 34,175,761 T1542S probably benign Het
Kcnj10 T C 1: 172,369,426 I169T probably damaging Het
Klk12 T C 7: 43,773,299 S217P probably damaging Het
Lancl1 T C 1: 67,038,535 N14S probably benign Het
Map2 A G 1: 66,414,648 Y899C probably damaging Het
Nr1h5 C T 3: 102,949,042 probably null Het
Nup98 T C 7: 102,125,284 T1515A probably damaging Het
Obscn A C 11: 59,080,840 V2183G probably damaging Het
Olfr666 C T 7: 104,892,719 R303Q probably benign Het
Osbpl8 A G 10: 111,269,427 T248A probably benign Het
Pias3 T A 3: 96,704,363 S533T probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Plxna1 A G 6: 89,340,591 Y680H probably damaging Het
Pnliprp2 A G 19: 58,775,227 N436S probably benign Het
Pold1 T A 7: 44,541,820 M196L probably benign Het
Prkdc G A 16: 15,714,263 V1464I probably benign Het
Ptk2b G A 14: 66,157,087 Q857* probably null Het
Qars T A 9: 108,510,132 L185Q probably damaging Het
Rabep1 A G 11: 70,940,464 N859S probably benign Het
Rnf19b A G 4: 129,083,778 H156R Het
Sart3 T C 5: 113,753,642 Q423R probably damaging Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Slc6a21 C T 7: 45,280,758 H194Y probably damaging Het
Tcf4 G A 18: 69,657,795 V420I probably damaging Het
Tjp1 T C 7: 65,318,573 D701G probably benign Het
Trim42 T C 9: 97,369,708 D46G probably damaging Het
Usp19 C T 9: 108,494,924 R429* probably null Het
Uxs1 T C 1: 43,764,927 N276S probably damaging Het
Vps50 A G 6: 3,588,078 I684V probably benign Het
Yars2 T A 16: 16,304,692 D307E probably benign Het
Zfp934 A T 13: 62,518,150 C258S Het
Other mutations in Kat6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Kat6a APN 8 22940263 missense unknown
IGL01093:Kat6a APN 8 22939321 missense possibly damaging 0.85
IGL01364:Kat6a APN 8 22907700 missense probably damaging 1.00
IGL01868:Kat6a APN 8 22926455 missense probably damaging 1.00
IGL02477:Kat6a APN 8 22929300 missense probably damaging 1.00
IGL02792:Kat6a APN 8 22938300 missense probably damaging 0.98
IGL03243:Kat6a APN 8 22910222 missense possibly damaging 0.77
Anning UTSW 8 22932113 critical splice acceptor site probably null
lord UTSW 8 22862364 missense probably damaging 1.00
master UTSW 8 22862788 missense probably damaging 0.99
R0018:Kat6a UTSW 8 22929273 missense possibly damaging 0.74
R0018:Kat6a UTSW 8 22929273 missense possibly damaging 0.74
R0284:Kat6a UTSW 8 22939803 missense unknown
R0636:Kat6a UTSW 8 22939323 missense possibly damaging 0.73
R0883:Kat6a UTSW 8 22862214 missense probably damaging 1.00
R1457:Kat6a UTSW 8 22938652 missense probably benign
R1753:Kat6a UTSW 8 22935797 missense probably benign 0.09
R2059:Kat6a UTSW 8 22939305 missense possibly damaging 0.53
R2155:Kat6a UTSW 8 22935647 small deletion probably benign
R2764:Kat6a UTSW 8 22932178 missense probably damaging 1.00
R3724:Kat6a UTSW 8 22862788 missense probably damaging 0.99
R3824:Kat6a UTSW 8 22862364 missense probably damaging 1.00
R3825:Kat6a UTSW 8 22862364 missense probably damaging 1.00
R4370:Kat6a UTSW 8 22911929 missense possibly damaging 0.95
R4371:Kat6a UTSW 8 22911929 missense possibly damaging 0.95
R4457:Kat6a UTSW 8 22932113 critical splice acceptor site probably null
R4600:Kat6a UTSW 8 22939311 missense probably benign 0.18
R4792:Kat6a UTSW 8 22940576 missense unknown
R4896:Kat6a UTSW 8 22938313 missense probably benign 0.07
R5069:Kat6a UTSW 8 22903133 missense probably damaging 1.00
R5192:Kat6a UTSW 8 22911713 missense probably damaging 0.99
R5196:Kat6a UTSW 8 22911713 missense probably damaging 0.99
R5279:Kat6a UTSW 8 22939648 small deletion probably benign
R5331:Kat6a UTSW 8 22939984 missense unknown
R5480:Kat6a UTSW 8 22938307 missense possibly damaging 0.77
R5659:Kat6a UTSW 8 22938160 nonsense probably null
R5759:Kat6a UTSW 8 22938012 missense probably benign 0.04
R5787:Kat6a UTSW 8 22932647 missense probably damaging 0.99
R5892:Kat6a UTSW 8 22938289 missense probably damaging 1.00
R5923:Kat6a UTSW 8 22939479 missense probably benign 0.00
R6049:Kat6a UTSW 8 22939037 missense possibly damaging 0.53
R6223:Kat6a UTSW 8 22940426 missense unknown
R6276:Kat6a UTSW 8 22939405 missense possibly damaging 0.96
R6279:Kat6a UTSW 8 22939612 missense unknown
R6300:Kat6a UTSW 8 22939612 missense unknown
R6307:Kat6a UTSW 8 22940368 missense unknown
R6562:Kat6a UTSW 8 22911787 missense probably benign 0.04
R6807:Kat6a UTSW 8 22940368 missense unknown
R6852:Kat6a UTSW 8 22938660 missense probably benign 0.18
R6875:Kat6a UTSW 8 22932361 missense probably benign 0.02
R6895:Kat6a UTSW 8 22935783 missense possibly damaging 0.88
R6913:Kat6a UTSW 8 22903199 missense possibly damaging 0.53
R7047:Kat6a UTSW 8 22938538 missense possibly damaging 0.53
R7243:Kat6a UTSW 8 22938775 missense probably benign 0.00
R7454:Kat6a UTSW 8 22935772 missense possibly damaging 0.56
X0050:Kat6a UTSW 8 22940481 nonsense probably null
Z1088:Kat6a UTSW 8 22935501 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTTTGTGCTTTAACAGGGCAC -3'
(R):5'- TGTCTCAGGGTAAGGTCCAC -3'

Sequencing Primer
(F):5'- TCCTGGTGTCAGTTAACATAGTTC -3'
(R):5'- CAGGGTAAGGTCCACTTCTGTC -3'
Posted On2019-06-26