Incidental Mutation 'R7235:Kalrn'
ID562791
Institutional Source Beutler Lab
Gene Symbol Kalrn
Ensembl Gene ENSMUSG00000061751
Gene Namekalirin, RhoGEF kinase
Synonyms2210407G14Rik, Hapip, E530005C20Rik, LOC224126
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.902) question?
Stock #R7235 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location33969073-34573532 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34175761 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 1542 (T1542S)
Ref Sequence ENSEMBL: ENSMUSP00000110611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076810] [ENSMUST00000089655] [ENSMUST00000114947] [ENSMUST00000114949] [ENSMUST00000114953] [ENSMUST00000114954] [ENSMUST00000114960] [ENSMUST00000151491]
Predicted Effect probably damaging
Transcript: ENSMUST00000076810
AA Change: T1524S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000076088
Gene: ENSMUSG00000061751
AA Change: T1524S

DomainStartEndE-ValueType
SEC14 20 159 2.22e-30 SMART
SPEC 173 289 5.32e-9 SMART
SPEC 295 397 1.19e-11 SMART
SPEC 400 515 1.83e0 SMART
SPEC 521 623 9.84e-13 SMART
SPEC 626 748 2.74e-2 SMART
SPEC 875 976 8.11e-14 SMART
SPEC 1106 1208 4.7e-10 SMART
RhoGEF 1258 1428 3.6e-56 SMART
PH 1442 1555 5.24e-8 SMART
SH3 1622 1683 1.23e-7 SMART
RhoGEF 1904 2074 1.47e-52 SMART
PH 2094 2199 9.87e-4 SMART
SH3 2295 2356 2.78e-2 SMART
IGc2 2455 2527 4.28e-12 SMART
FN3 2541 2623 3.07e-11 SMART
S_TKc 2656 2910 1.28e-71 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000089655
AA Change: T1551S

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000087084
Gene: ENSMUSG00000061751
AA Change: T1551S

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
SEC14 38 177 2.22e-30 SMART
SPEC 191 307 5.32e-9 SMART
SPEC 313 415 1.19e-11 SMART
SPEC 418 533 1.83e0 SMART
SPEC 539 641 9.84e-13 SMART
SPEC 644 766 2.74e-2 SMART
SPEC 893 1003 1.85e-8 SMART
SPEC 1133 1235 4.7e-10 SMART
RhoGEF 1285 1455 3.6e-56 SMART
PH 1469 1582 5.24e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114947
SMART Domains Protein: ENSMUSP00000110597
Gene: ENSMUSG00000061751

DomainStartEndE-ValueType
SPEC 3 112 4.22e-3 SMART
internal_repeat_1 128 187 9.63e-6 PROSPERO
SPEC 239 349 1.85e-8 SMART
SPEC 479 581 4.7e-10 SMART
RhoGEF 631 801 3.6e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114949
AA Change: T901S

PolyPhen 2 Score 0.183 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000110599
Gene: ENSMUSG00000061751
AA Change: T901S

DomainStartEndE-ValueType
SPEC 3 125 2.74e-2 SMART
internal_repeat_1 141 204 2.9e-5 PROSPERO
SPEC 252 353 8.11e-14 SMART
SPEC 483 585 4.7e-10 SMART
RhoGEF 635 805 3.6e-56 SMART
PH 819 932 5.24e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114953
AA Change: T910S

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000110603
Gene: ENSMUSG00000061751
AA Change: T910S

DomainStartEndE-ValueType
SPEC 3 125 2.74e-2 SMART
internal_repeat_1 141 204 4.18e-5 PROSPERO
coiled coil region 217 248 N/A INTRINSIC
SPEC 252 362 1.85e-8 SMART
SPEC 492 594 4.7e-10 SMART
RhoGEF 644 814 3.6e-56 SMART
PH 828 941 5.24e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114954
AA Change: T910S

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000110604
Gene: ENSMUSG00000061751
AA Change: T910S

DomainStartEndE-ValueType
SPEC 3 125 2.74e-2 SMART
internal_repeat_1 141 204 4.18e-5 PROSPERO
coiled coil region 217 248 N/A INTRINSIC
SPEC 252 362 1.85e-8 SMART
SPEC 492 594 4.7e-10 SMART
RhoGEF 644 814 3.6e-56 SMART
PH 828 941 5.24e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114960
AA Change: T1542S

PolyPhen 2 Score 0.183 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000110611
Gene: ENSMUSG00000061751
AA Change: T1542S

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
SEC14 38 177 2.22e-30 SMART
SPEC 191 307 5.32e-9 SMART
SPEC 313 415 1.19e-11 SMART
SPEC 418 533 1.83e0 SMART
SPEC 539 641 9.84e-13 SMART
SPEC 644 766 2.74e-2 SMART
SPEC 893 994 8.11e-14 SMART
SPEC 1124 1226 4.7e-10 SMART
RhoGEF 1276 1446 3.6e-56 SMART
PH 1460 1573 5.24e-8 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000116188
Gene: ENSMUSG00000061751
AA Change: T1519S

DomainStartEndE-ValueType
SEC14 16 155 2.22e-30 SMART
SPEC 169 285 5.32e-9 SMART
SPEC 291 393 1.19e-11 SMART
SPEC 396 511 1.83e0 SMART
SPEC 517 619 9.84e-13 SMART
SPEC 622 744 2.74e-2 SMART
SPEC 871 972 8.11e-14 SMART
SPEC 1102 1204 4.7e-10 SMART
RhoGEF 1254 1424 3.6e-56 SMART
PH 1438 1551 5.24e-8 SMART
SH3 1618 1679 1.23e-7 SMART
RhoGEF 1900 2070 1.47e-52 SMART
PH 2090 2195 9.87e-4 SMART
SH3 2291 2352 2.78e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151491
AA Change: T1298S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000123416
Gene: ENSMUSG00000061751
AA Change: T1298S

DomainStartEndE-ValueType
SEC14 26 165 2.22e-30 SMART
SPEC 179 295 5.32e-9 SMART
SPEC 301 403 1.19e-11 SMART
SPEC 640 750 1.85e-8 SMART
SPEC 880 982 4.7e-10 SMART
RhoGEF 1032 1202 3.6e-56 SMART
PH 1216 1329 5.24e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntington's disease (HD), a neurodegenerative disorder characterized by loss of striatal neurons, is caused by an expansion of a polyglutamine tract in the HD protein huntingtin. This gene encodes a protein that interacts with the huntingtin-associated protein 1, which is a huntingtin binding protein that may function in vesicle trafficking. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele specific for isoform 7 exhibit decreased anxiety-related behavior, contextual conditioning, and synapse formation. Mice homozygous for another knock-out allele exhibit impaired AMPA-mediated synaptic currents and abnormal behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik T G 2: 85,500,219 H248P probably damaging Het
Ahnak T A 19: 9,012,488 M3712K unknown Het
Bri3bp A G 5: 125,441,684 E8G unknown Het
Brip1 C T 11: 86,138,875 R611Q possibly damaging Het
C330027C09Rik T A 16: 49,001,059 L176H probably damaging Het
Carm1 T G 9: 21,587,405 probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Clk4 A G 11: 51,276,185 D330G probably damaging Het
Dcdc2c A G 12: 28,470,719 S453P Het
Ddx46 G A 13: 55,663,240 V550I probably benign Het
Dennd1a T C 2: 37,801,061 N676D probably benign Het
Dnah3 T C 7: 120,032,670 N1365S probably damaging Het
Dsg1b T C 18: 20,399,423 V508A probably benign Het
Dus2 T C 8: 106,015,955 V39A possibly damaging Het
Dync1li1 T C 9: 114,715,163 V301A possibly damaging Het
Efcc1 T G 6: 87,753,798 S513A probably benign Het
Eif3f T C 7: 108,938,088 V167A possibly damaging Het
Ephb2 A G 4: 136,693,828 Y404H probably damaging Het
Eqtn A T 4: 94,923,699 D152E probably damaging Het
Ercc5 A C 1: 44,178,203 K902T possibly damaging Het
Erlec1 T A 11: 30,950,751 E139V possibly damaging Het
Evl G A 12: 108,648,460 G38R probably damaging Het
Foxd2 T C 4: 114,908,271 N184S unknown Het
Frem3 T C 8: 80,690,725 Y2020H probably benign Het
Ganc T C 2: 120,433,717 F384L probably damaging Het
Gm11756 G T 4: 73,917,571 L219M probably benign Het
Grin2a A G 16: 9,579,265 L986P probably damaging Het
Ift140 A T 17: 25,020,645 D92V possibly damaging Het
Inpp5b A G 4: 124,751,392 K158E probably benign Het
Iscu T A 5: 113,776,882 S152T probably benign Het
Kat6a A G 8: 22,914,269 D454G possibly damaging Het
Kcnj10 T C 1: 172,369,426 I169T probably damaging Het
Klk12 T C 7: 43,773,299 S217P probably damaging Het
Lancl1 T C 1: 67,038,535 N14S probably benign Het
Map2 A G 1: 66,414,648 Y899C probably damaging Het
Nr1h5 C T 3: 102,949,042 probably null Het
Nup98 T C 7: 102,125,284 T1515A probably damaging Het
Obscn A C 11: 59,080,840 V2183G probably damaging Het
Olfr666 C T 7: 104,892,719 R303Q probably benign Het
Osbpl8 A G 10: 111,269,427 T248A probably benign Het
Pias3 T A 3: 96,704,363 S533T probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Plxna1 A G 6: 89,340,591 Y680H probably damaging Het
Pnliprp2 A G 19: 58,775,227 N436S probably benign Het
Pold1 T A 7: 44,541,820 M196L probably benign Het
Prkdc G A 16: 15,714,263 V1464I probably benign Het
Ptk2b G A 14: 66,157,087 Q857* probably null Het
Qars T A 9: 108,510,132 L185Q probably damaging Het
Rabep1 A G 11: 70,940,464 N859S probably benign Het
Rnf19b A G 4: 129,083,778 H156R Het
Sart3 T C 5: 113,753,642 Q423R probably damaging Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Slc6a21 C T 7: 45,280,758 H194Y probably damaging Het
Tcf4 G A 18: 69,657,795 V420I probably damaging Het
Tjp1 T C 7: 65,318,573 D701G probably benign Het
Trim42 T C 9: 97,369,708 D46G probably damaging Het
Usp19 C T 9: 108,494,924 R429* probably null Het
Uxs1 T C 1: 43,764,927 N276S probably damaging Het
Vps50 A G 6: 3,588,078 I684V probably benign Het
Yars2 T A 16: 16,304,692 D307E probably benign Het
Zfp934 A T 13: 62,518,150 C258S Het
Other mutations in Kalrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Kalrn APN 16 34175722 splice site probably benign
IGL01364:Kalrn APN 16 34262629 missense probably damaging 1.00
IGL01510:Kalrn APN 16 34235330 missense possibly damaging 0.52
IGL01664:Kalrn APN 16 34294161 missense probably damaging 1.00
IGL01934:Kalrn APN 16 34198512 splice site probably null
IGL02059:Kalrn APN 16 34252341 missense possibly damaging 0.95
IGL02102:Kalrn APN 16 34220222 missense probably damaging 1.00
IGL02306:Kalrn APN 16 34310527 missense probably damaging 0.97
IGL02328:Kalrn APN 16 34332224 missense probably damaging 0.98
IGL02532:Kalrn APN 16 34360846 missense probably damaging 1.00
IGL02685:Kalrn APN 16 34513959 nonsense probably null
IGL02696:Kalrn APN 16 34220114 missense probably damaging 1.00
IGL02708:Kalrn APN 16 34392050 missense probably damaging 1.00
IGL02937:Kalrn APN 16 34220130 nonsense probably null
IGL03188:Kalrn APN 16 34314192 missense probably benign 0.01
IGL03289:Kalrn APN 16 34385297 missense possibly damaging 0.90
IGL03408:Kalrn APN 16 34314176 missense probably damaging 0.99
R6808_Kalrn_672 UTSW 16 34027976 missense probably damaging 1.00
PIT4498001:Kalrn UTSW 16 34031582 missense possibly damaging 0.81
R0019:Kalrn UTSW 16 34198514 splice site probably benign
R0043:Kalrn UTSW 16 34054906 missense probably damaging 1.00
R0052:Kalrn UTSW 16 34357171 missense probably damaging 1.00
R0066:Kalrn UTSW 16 34203957 missense probably damaging 1.00
R0098:Kalrn UTSW 16 33975619 missense possibly damaging 0.89
R0098:Kalrn UTSW 16 33975619 missense possibly damaging 0.89
R0111:Kalrn UTSW 16 34031590 missense probably damaging 1.00
R0113:Kalrn UTSW 16 34049936 intron probably benign
R0183:Kalrn UTSW 16 34171379 splice site probably null
R0422:Kalrn UTSW 16 34314273 missense probably damaging 0.99
R0498:Kalrn UTSW 16 34054891 missense possibly damaging 0.61
R0614:Kalrn UTSW 16 33993670 splice site probably benign
R0656:Kalrn UTSW 16 34032467 missense probably damaging 1.00
R0671:Kalrn UTSW 16 34116408 missense probably benign 0.04
R0707:Kalrn UTSW 16 34010581 missense possibly damaging 0.88
R0709:Kalrn UTSW 16 34035554 missense probably damaging 1.00
R0834:Kalrn UTSW 16 34049919 missense possibly damaging 0.94
R0976:Kalrn UTSW 16 34385390 missense probably damaging 1.00
R1297:Kalrn UTSW 16 34016498 missense probably damaging 0.99
R1355:Kalrn UTSW 16 33975584 missense possibly damaging 0.74
R1370:Kalrn UTSW 16 33975584 missense possibly damaging 0.74
R1389:Kalrn UTSW 16 33988803 missense probably benign 0.01
R1398:Kalrn UTSW 16 34212820 missense probably damaging 1.00
R1427:Kalrn UTSW 16 33975754 missense probably damaging 1.00
R1458:Kalrn UTSW 16 34174487 missense probably damaging 1.00
R1470:Kalrn UTSW 16 34187471 missense probably damaging 1.00
R1470:Kalrn UTSW 16 34187471 missense probably damaging 1.00
R1557:Kalrn UTSW 16 34314278 missense possibly damaging 0.92
R1559:Kalrn UTSW 16 34010548 missense possibly damaging 0.92
R1654:Kalrn UTSW 16 33975738 missense probably damaging 1.00
R1703:Kalrn UTSW 16 34205326 missense probably damaging 1.00
R1759:Kalrn UTSW 16 34360950 missense probably damaging 0.97
R1764:Kalrn UTSW 16 34212873 missense probably damaging 1.00
R1824:Kalrn UTSW 16 34294215 missense probably damaging 1.00
R1845:Kalrn UTSW 16 34356961 missense probably damaging 0.99
R1850:Kalrn UTSW 16 33975923 missense probably damaging 0.98
R1921:Kalrn UTSW 16 34392093 missense probably benign 0.02
R1922:Kalrn UTSW 16 34392093 missense probably benign 0.02
R1970:Kalrn UTSW 16 33977524 critical splice donor site probably null
R1991:Kalrn UTSW 16 33975738 missense probably damaging 1.00
R1992:Kalrn UTSW 16 33975738 missense probably damaging 1.00
R2001:Kalrn UTSW 16 34028045 missense probably damaging 1.00
R2025:Kalrn UTSW 16 34189736 missense probably damaging 0.96
R2048:Kalrn UTSW 16 34252310 missense probably benign 0.18
R2076:Kalrn UTSW 16 34332143 missense probably benign 0.15
R2118:Kalrn UTSW 16 34332230 missense possibly damaging 0.84
R2136:Kalrn UTSW 16 34307724 missense possibly damaging 0.82
R2145:Kalrn UTSW 16 34009262 unclassified probably benign
R2193:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2195:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2234:Kalrn UTSW 16 34176262 splice site probably null
R2404:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2405:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2408:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2411:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2570:Kalrn UTSW 16 34310495 missense probably damaging 1.00
R2903:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2904:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2924:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R3411:Kalrn UTSW 16 34212272 missense probably benign 0.07
R3693:Kalrn UTSW 16 34357315 missense probably damaging 1.00
R3709:Kalrn UTSW 16 34392030 splice site probably null
R3788:Kalrn UTSW 16 34220240 missense probably damaging 1.00
R3833:Kalrn UTSW 16 34039889 nonsense probably null
R3871:Kalrn UTSW 16 34203856 splice site probably null
R3934:Kalrn UTSW 16 34310531 missense probably benign 0.34
R4033:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4056:Kalrn UTSW 16 34314209 missense probably damaging 0.99
R4057:Kalrn UTSW 16 34314209 missense probably damaging 0.99
R4303:Kalrn UTSW 16 34235391 missense probably damaging 1.00
R4402:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4444:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4482:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4487:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4558:Kalrn UTSW 16 33987208 missense possibly damaging 0.46
R4572:Kalrn UTSW 16 34392042 missense probably damaging 0.98
R4583:Kalrn UTSW 16 34235267 missense probably damaging 1.00
R4604:Kalrn UTSW 16 34513926 missense possibly damaging 0.46
R4620:Kalrn UTSW 16 34028705 missense probably damaging 0.99
R4651:Kalrn UTSW 16 34176391 missense probably damaging 1.00
R4703:Kalrn UTSW 16 34203957 missense probably damaging 1.00
R4704:Kalrn UTSW 16 34203957 missense probably damaging 1.00
R4705:Kalrn UTSW 16 34203957 missense probably damaging 1.00
R4760:Kalrn UTSW 16 34198487 missense probably damaging 1.00
R4793:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4794:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4811:Kalrn UTSW 16 34356969 missense probably damaging 1.00
R4816:Kalrn UTSW 16 34514019 unclassified probably benign
R4888:Kalrn UTSW 16 34171330 missense probably damaging 1.00
R4952:Kalrn UTSW 16 34357415 intron probably null
R5030:Kalrn UTSW 16 33975742 missense probably benign 0.00
R5045:Kalrn UTSW 16 34314352 nonsense probably null
R5117:Kalrn UTSW 16 34033601 critical splice acceptor site probably null
R5289:Kalrn UTSW 16 34252341 missense possibly damaging 0.95
R5426:Kalrn UTSW 16 34262653 missense probably damaging 1.00
R5432:Kalrn UTSW 16 34053622 missense probably damaging 1.00
R5611:Kalrn UTSW 16 34175780 missense probably damaging 1.00
R5629:Kalrn UTSW 16 34039934 missense possibly damaging 0.77
R5635:Kalrn UTSW 16 34014084 missense probably damaging 1.00
R5713:Kalrn UTSW 16 34016579 missense probably benign
R5716:Kalrn UTSW 16 33987176 missense probably benign 0.01
R5772:Kalrn UTSW 16 33975820 missense probably damaging 1.00
R5797:Kalrn UTSW 16 34212249 missense probably damaging 0.98
R5835:Kalrn UTSW 16 33987091 missense probably benign 0.28
R5895:Kalrn UTSW 16 33975435 utr 3 prime probably benign
R5924:Kalrn UTSW 16 34243833 missense probably damaging 1.00
R5999:Kalrn UTSW 16 34357343 missense probably damaging 1.00
R6010:Kalrn UTSW 16 34010580 missense probably benign 0.06
R6052:Kalrn UTSW 16 34360885 missense probably damaging 1.00
R6122:Kalrn UTSW 16 33985191 missense possibly damaging 0.82
R6128:Kalrn UTSW 16 34212885 missense probably damaging 0.99
R6136:Kalrn UTSW 16 34357111 missense probably damaging 1.00
R6178:Kalrn UTSW 16 34053639 missense possibly damaging 0.88
R6229:Kalrn UTSW 16 34055071 missense probably damaging 1.00
R6376:Kalrn UTSW 16 33975991 missense probably benign
R6397:Kalrn UTSW 16 33992985 missense probably damaging 1.00
R6429:Kalrn UTSW 16 34332164 missense possibly damaging 0.85
R6473:Kalrn UTSW 16 34205302 missense probably damaging 1.00
R6481:Kalrn UTSW 16 34360984 missense probably damaging 1.00
R6597:Kalrn UTSW 16 34182747 missense probably damaging 1.00
R6736:Kalrn UTSW 16 34217923 missense probably damaging 1.00
R6808:Kalrn UTSW 16 34027976 missense probably damaging 1.00
R6897:Kalrn UTSW 16 33975703 missense probably damaging 0.99
R6955:Kalrn UTSW 16 34220136 missense probably damaging 1.00
R7060:Kalrn UTSW 16 34357048 missense probably damaging 0.99
R7064:Kalrn UTSW 16 34217891 missense probably damaging 1.00
R7132:Kalrn UTSW 16 34256227 missense unknown
R7154:Kalrn UTSW 16 34212157 critical splice donor site probably null
R7181:Kalrn UTSW 16 34163077 missense probably benign 0.00
R7234:Kalrn UTSW 16 34176422 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- GGAGAATATCTGCCTTCAAGATTC -3'
(R):5'- TGATTGACAGAAGCCCCTCC -3'

Sequencing Primer
(F):5'- GAATATCTGCCTTCAAGATTCTGGGC -3'
(R):5'- ACAGAAGCCCCTCCCTTGG -3'
Posted On2019-06-26