Incidental Mutation 'R7237:Fcgr3'
ID562867
Institutional Source Beutler Lab
Gene Symbol Fcgr3
Ensembl Gene ENSMUSG00000059498
Gene NameFc receptor, IgG, low affinity III
SynonymsCD16, FcgammaRIII, Fcg receptor III
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7237 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location171051174-171064935 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 171059301 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 18 (L18P)
Ref Sequence ENSEMBL: ENSMUSP00000131938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164044] [ENSMUST00000164179] [ENSMUST00000169017]
Predicted Effect probably damaging
Transcript: ENSMUST00000164044
AA Change: L18P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131938
Gene: ENSMUSG00000059498
AA Change: L18P

DomainStartEndE-ValueType
low complexity region 18 27 N/A INTRINSIC
IG 47 120 1.2e-1 SMART
IG 128 206 1.24e-8 SMART
transmembrane domain 219 241 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164179
AA Change: L18P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133039
Gene: ENSMUSG00000059498
AA Change: L18P

DomainStartEndE-ValueType
low complexity region 18 27 N/A INTRINSIC
PDB:3WJL|C 35 74 6e-11 PDB
SCOP:d1f2qa1 39 74 8e-7 SMART
Blast:IG 46 74 4e-15 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000169017
AA Change: L18P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131836
Gene: ENSMUSG00000059498
AA Change: L18P

DomainStartEndE-ValueType
low complexity region 18 27 N/A INTRINSIC
IG 46 119 1.2e-1 SMART
IG 127 205 1.24e-8 SMART
transmembrane domain 218 240 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one member of a family of immunoglobulin Fc receptor genes found on the surface of many immune response cells. The protein encoded by this gene is a cell surface receptor found on phagocytic cells such as macrophages and neutrophils, and is involved in the process of phagocytosis and clearing of immune complexes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygotes for a targeted null mutation lack IgG-mediated mast cell degranulation and have impaired IgG-dependent anaphylaxis and Arthus reactions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap21 A T 2: 20,849,972 C1536* probably null Het
Armc9 C A 1: 86,164,849 Q169K possibly damaging Het
Aspm T A 1: 139,477,929 M1518K possibly damaging Het
AU018091 A G 7: 3,159,166 I360T probably benign Het
BB014433 C A 8: 15,041,765 V363L probably benign Het
Cacna1g T C 11: 94,437,879 S1071G probably benign Het
Card9 A T 2: 26,356,775 S354T probably benign Het
Ccdc87 A G 19: 4,839,762 N94S probably benign Het
Cdc27 A G 11: 104,517,419 V555A probably benign Het
Coro1a T A 7: 126,700,306 D411V probably benign Het
Cybrd1 GGTCCTGCAC G 2: 71,118,209 probably benign Het
Cyth1 A T 11: 118,185,495 I95N probably damaging Het
Ddx58 T A 4: 40,205,938 I885F probably benign Het
Dnah7b A T 1: 46,139,966 E933V probably damaging Het
Dync2h1 A T 9: 6,993,966 I3968N probably benign Het
Fam126b G A 1: 58,529,948 Q491* probably null Het
Fat3 G A 9: 16,377,214 L338F probably damaging Het
Gbp5 T C 3: 142,507,700 V459A probably benign Het
Gja4 A T 4: 127,312,163 M269K probably benign Het
Gm4787 A G 12: 81,377,668 V572A probably damaging Het
Gys1 A G 7: 45,455,162 D671G probably benign Het
Haspin T C 11: 73,136,886 N459S probably benign Het
Hdac10 G T 15: 89,125,377 Q451K probably benign Het
Hdac9 T C 12: 34,374,140 probably null Het
Hmcn1 A G 1: 150,722,643 V1636A probably damaging Het
Hpca A G 4: 129,118,614 L43P probably damaging Het
Insm1 C A 2: 146,222,528 A88E possibly damaging Het
Itga9 A G 9: 118,636,602 K175E probably benign Het
Kif13a A G 13: 46,809,156 probably null Het
Kif20b T A 19: 34,950,605 L1089H probably damaging Het
Lamp5 A T 2: 136,059,835 H152L probably benign Het
Lrp4 T C 2: 91,473,183 F76L probably benign Het
Magi3 T C 3: 104,027,911 D902G probably damaging Het
Map10 C T 8: 125,671,224 P452L probably benign Het
Mapk6 A G 9: 75,397,613 L174P probably damaging Het
Ndufa4 C T 6: 11,906,019 probably null Het
Nedd4 A T 9: 72,725,064 E393D probably benign Het
Nlrp4b G A 7: 10,715,216 V449I probably benign Het
Nufip2 T A 11: 77,692,770 N503K probably benign Het
Olfr220 C T 1: 174,449,339 R239C probably benign Het
Olfr455 T C 6: 42,538,647 D125G probably damaging Het
P4ha1 A G 10: 59,348,243 T176A probably benign Het
Palm3 A G 8: 84,029,488 K543R probably benign Het
Parvg G A 15: 84,341,356 A302T probably benign Het
Pcdh15 A G 10: 74,584,191 D1227G possibly damaging Het
Pdzd8 C T 19: 59,345,139 G150D probably damaging Het
Pitpnm2 A G 5: 124,125,297 probably null Het
Pld5 T C 1: 176,274,735 Q47R possibly damaging Het
Ppp2r5d T C 17: 46,686,280 S329G possibly damaging Het
Prss56 T C 1: 87,184,915 V144A probably damaging Het
Psg28 A T 7: 18,427,844 Y245N possibly damaging Het
Ptpn3 C T 4: 57,239,625 V302I probably damaging Het
Ptprn2 A G 12: 117,161,727 H627R probably benign Het
Rasgrp2 A T 19: 6,404,808 H226L possibly damaging Het
Rbm20 C T 19: 53,851,499 T973M probably benign Het
Riok2 T A 17: 17,377,783 L44Q probably damaging Het
Rusc1 G T 3: 89,091,498 Q326K possibly damaging Het
Sart3 A T 5: 113,754,246 H397Q possibly damaging Het
Sec31b T A 19: 44,517,708 T920S probably damaging Het
Serpinb13 A G 1: 106,998,949 E225G probably damaging Het
Slc25a47 T C 12: 108,855,460 L165P probably damaging Het
Slc2a10 G A 2: 165,515,277 V286I probably benign Het
Slc39a13 G T 2: 91,065,634 T174N probably benign Het
Slc7a13 T A 4: 19,839,364 N322K probably benign Het
Stk38 T C 17: 28,974,646 T326A possibly damaging Het
Sult1a1 T C 7: 126,673,450 M244V probably benign Het
Tas2r144 C T 6: 42,215,866 T180I probably damaging Het
Tbc1d12 T A 19: 38,898,902 M366K probably benign Het
Terb1 T C 8: 104,495,327 I147V possibly damaging Het
Tldc1 C T 8: 119,762,315 G410S probably damaging Het
Tmem5 A T 10: 122,081,618 L330* probably null Het
Tnik T C 3: 28,638,419 Y820H probably damaging Het
Tnxb C A 17: 34,682,196 L995I possibly damaging Het
Trim34b A G 7: 104,329,587 T14A possibly damaging Het
Urb1 T C 16: 90,791,166 E418G probably damaging Het
Vmn1r12 T A 6: 57,159,565 C216S possibly damaging Het
Vmn2r90 T A 17: 17,703,987 V16E possibly damaging Het
Vps11 A T 9: 44,354,506 V492D probably damaging Het
Zc3h14 T A 12: 98,780,149 M539K probably benign Het
Zfp871 A T 17: 32,775,315 H295Q probably damaging Het
Other mutations in Fcgr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01653:Fcgr3 APN 1 171059280 missense probably damaging 1.00
PIT4696001:Fcgr3 UTSW 1 171057750 missense probably damaging 1.00
R1722:Fcgr3 UTSW 1 171054119 missense possibly damaging 0.89
R3734:Fcgr3 UTSW 1 171057874 missense probably benign 0.04
R4207:Fcgr3 UTSW 1 171054075 missense probably benign 0.29
R5885:Fcgr3 UTSW 1 171057711 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCTGAGACTAAAACACGATC -3'
(R):5'- ATCTGTCAGGCTGAGTCCAC -3'

Sequencing Primer
(F):5'- TCTCACAAAGCCAGGTTGG -3'
(R):5'- GTCAGGCTGAGTCCACATCTTG -3'
Posted On2019-06-26