Incidental Mutation 'R7237:Tnik'
ID562878
Institutional Source Beutler Lab
Gene Symbol Tnik
Ensembl Gene ENSMUSG00000027692
Gene NameTRAF2 and NCK interacting kinase
SynonymsC630040K21Rik, 1500031A17Rik, 4831440I19Rik, C530008O15Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7237 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location28263214-28675858 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28638419 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 820 (Y820H)
Ref Sequence ENSEMBL: ENSMUSP00000124387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159236] [ENSMUST00000159308] [ENSMUST00000159680] [ENSMUST00000160307] [ENSMUST00000160518] [ENSMUST00000160934] [ENSMUST00000161964] [ENSMUST00000162485] [ENSMUST00000162777]
Predicted Effect probably benign
Transcript: ENSMUST00000159236
AA Change: Y838H

PolyPhen 2 Score 0.120 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000124681
Gene: ENSMUSG00000027692
AA Change: Y838H

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 691 726 N/A INTRINSIC
low complexity region 793 812 N/A INTRINSIC
low complexity region 951 958 N/A INTRINSIC
CNH 1005 1303 1.92e-117 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000159308
AA Change: Y791H

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000125466
Gene: ENSMUSG00000027692
AA Change: Y791H

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 636 671 N/A INTRINSIC
low complexity region 746 765 N/A INTRINSIC
low complexity region 904 911 N/A INTRINSIC
CNH 958 1256 1.92e-117 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159680
AA Change: Y867H

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000124876
Gene: ENSMUSG00000027692
AA Change: Y867H

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 720 755 N/A INTRINSIC
low complexity region 822 841 N/A INTRINSIC
low complexity region 980 987 N/A INTRINSIC
CNH 1034 1332 1.92e-117 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160307
AA Change: Y875H

PolyPhen 2 Score 0.240 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000125081
Gene: ENSMUSG00000027692
AA Change: Y875H

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 720 755 N/A INTRINSIC
low complexity region 830 849 N/A INTRINSIC
low complexity region 988 995 N/A INTRINSIC
CNH 1042 1340 1.92e-117 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160518
AA Change: Y846H

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124011
Gene: ENSMUSG00000027692
AA Change: Y846H

DomainStartEndE-ValueType
S_TKc 25 289 5.9e-99 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 691 726 N/A INTRINSIC
low complexity region 801 820 N/A INTRINSIC
low complexity region 959 966 N/A INTRINSIC
CNH 1013 1311 9.3e-120 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160934
SMART Domains Protein: ENSMUSP00000123859
Gene: ENSMUSG00000027692

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 25 212 2.2e-37 PFAM
Pfam:Pkinase 25 219 5.9e-52 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000161964
AA Change: Y783H
SMART Domains Protein: ENSMUSP00000125411
Gene: ENSMUSG00000027692
AA Change: Y783H

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 636 671 N/A INTRINSIC
low complexity region 738 757 N/A INTRINSIC
low complexity region 896 903 N/A INTRINSIC
CNH 950 1248 1.92e-117 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162037
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162225
Predicted Effect probably damaging
Transcript: ENSMUST00000162485
AA Change: Y820H

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124387
Gene: ENSMUSG00000027692
AA Change: Y820H

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 665 700 N/A INTRINSIC
low complexity region 775 794 N/A INTRINSIC
low complexity region 933 940 N/A INTRINSIC
CNH 987 1285 1.92e-117 SMART
Predicted Effect unknown
Transcript: ENSMUST00000162777
AA Change: Y812H
SMART Domains Protein: ENSMUSP00000124726
Gene: ENSMUSG00000027692
AA Change: Y812H

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 665 700 N/A INTRINSIC
low complexity region 767 786 N/A INTRINSIC
low complexity region 925 932 N/A INTRINSIC
CNH 979 1277 1.92e-117 SMART
Meta Mutation Damage Score 0.098 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Germinal center kinases (GCKs), such as TNIK, are characterized by an N-terminal kinase domain and a C-terminal GCK domain that serves a regulatory function (Fu et al., 1999 [PubMed 10521462]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired postsynaptic signaling and cognitive function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap21 A T 2: 20,849,972 C1536* probably null Het
Armc9 C A 1: 86,164,849 Q169K possibly damaging Het
Aspm T A 1: 139,477,929 M1518K possibly damaging Het
AU018091 A G 7: 3,159,166 I360T probably benign Het
BB014433 C A 8: 15,041,765 V363L probably benign Het
Cacna1g T C 11: 94,437,879 S1071G probably benign Het
Card9 A T 2: 26,356,775 S354T probably benign Het
Ccdc87 A G 19: 4,839,762 N94S probably benign Het
Cdc27 A G 11: 104,517,419 V555A probably benign Het
Coro1a T A 7: 126,700,306 D411V probably benign Het
Cybrd1 GGTCCTGCAC G 2: 71,118,209 probably benign Het
Cyth1 A T 11: 118,185,495 I95N probably damaging Het
Ddx58 T A 4: 40,205,938 I885F probably benign Het
Dnah7b A T 1: 46,139,966 E933V probably damaging Het
Dync2h1 A T 9: 6,993,966 I3968N probably benign Het
Fam126b G A 1: 58,529,948 Q491* probably null Het
Fat3 G A 9: 16,377,214 L338F probably damaging Het
Fcgr3 A G 1: 171,059,301 L18P probably damaging Het
Gbp5 T C 3: 142,507,700 V459A probably benign Het
Gja4 A T 4: 127,312,163 M269K probably benign Het
Gm4787 A G 12: 81,377,668 V572A probably damaging Het
Gys1 A G 7: 45,455,162 D671G probably benign Het
Haspin T C 11: 73,136,886 N459S probably benign Het
Hdac10 G T 15: 89,125,377 Q451K probably benign Het
Hdac9 T C 12: 34,374,140 probably null Het
Hmcn1 A G 1: 150,722,643 V1636A probably damaging Het
Hpca A G 4: 129,118,614 L43P probably damaging Het
Insm1 C A 2: 146,222,528 A88E possibly damaging Het
Itga9 A G 9: 118,636,602 K175E probably benign Het
Kif13a A G 13: 46,809,156 probably null Het
Kif20b T A 19: 34,950,605 L1089H probably damaging Het
Lamp5 A T 2: 136,059,835 H152L probably benign Het
Lrp4 T C 2: 91,473,183 F76L probably benign Het
Magi3 T C 3: 104,027,911 D902G probably damaging Het
Map10 C T 8: 125,671,224 P452L probably benign Het
Mapk6 A G 9: 75,397,613 L174P probably damaging Het
Ndufa4 C T 6: 11,906,019 probably null Het
Nedd4 A T 9: 72,725,064 E393D probably benign Het
Nlrp4b G A 7: 10,715,216 V449I probably benign Het
Nufip2 T A 11: 77,692,770 N503K probably benign Het
Olfr220 C T 1: 174,449,339 R239C probably benign Het
Olfr455 T C 6: 42,538,647 D125G probably damaging Het
P4ha1 A G 10: 59,348,243 T176A probably benign Het
Palm3 A G 8: 84,029,488 K543R probably benign Het
Parvg G A 15: 84,341,356 A302T probably benign Het
Pcdh15 A G 10: 74,584,191 D1227G possibly damaging Het
Pdzd8 C T 19: 59,345,139 G150D probably damaging Het
Pitpnm2 A G 5: 124,125,297 probably null Het
Pld5 T C 1: 176,274,735 Q47R possibly damaging Het
Ppp2r5d T C 17: 46,686,280 S329G possibly damaging Het
Prss56 T C 1: 87,184,915 V144A probably damaging Het
Psg28 A T 7: 18,427,844 Y245N possibly damaging Het
Ptpn3 C T 4: 57,239,625 V302I probably damaging Het
Ptprn2 A G 12: 117,161,727 H627R probably benign Het
Rasgrp2 A T 19: 6,404,808 H226L possibly damaging Het
Rbm20 C T 19: 53,851,499 T973M probably benign Het
Riok2 T A 17: 17,377,783 L44Q probably damaging Het
Rusc1 G T 3: 89,091,498 Q326K possibly damaging Het
Sart3 A T 5: 113,754,246 H397Q possibly damaging Het
Sec31b T A 19: 44,517,708 T920S probably damaging Het
Serpinb13 A G 1: 106,998,949 E225G probably damaging Het
Slc25a47 T C 12: 108,855,460 L165P probably damaging Het
Slc2a10 G A 2: 165,515,277 V286I probably benign Het
Slc39a13 G T 2: 91,065,634 T174N probably benign Het
Slc7a13 T A 4: 19,839,364 N322K probably benign Het
Stk38 T C 17: 28,974,646 T326A possibly damaging Het
Sult1a1 T C 7: 126,673,450 M244V probably benign Het
Tas2r144 C T 6: 42,215,866 T180I probably damaging Het
Tbc1d12 T A 19: 38,898,902 M366K probably benign Het
Terb1 T C 8: 104,495,327 I147V possibly damaging Het
Tldc1 C T 8: 119,762,315 G410S probably damaging Het
Tmem5 A T 10: 122,081,618 L330* probably null Het
Tnxb C A 17: 34,682,196 L995I possibly damaging Het
Trim34b A G 7: 104,329,587 T14A possibly damaging Het
Urb1 T C 16: 90,791,166 E418G probably damaging Het
Vmn1r12 T A 6: 57,159,565 C216S possibly damaging Het
Vmn2r90 T A 17: 17,703,987 V16E possibly damaging Het
Vps11 A T 9: 44,354,506 V492D probably damaging Het
Zc3h14 T A 12: 98,780,149 M539K probably benign Het
Zfp871 A T 17: 32,775,315 H295Q probably damaging Het
Other mutations in Tnik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Tnik APN 3 28654218 missense probably damaging 1.00
IGL00726:Tnik APN 3 28532898 missense probably damaging 1.00
IGL01022:Tnik APN 3 28625228 splice site probably null
IGL01145:Tnik APN 3 28604167 intron probably benign
IGL01664:Tnik APN 3 28638479 missense probably damaging 1.00
IGL01843:Tnik APN 3 28570858 splice site probably null
IGL02378:Tnik APN 3 28638459 nonsense probably null
IGL02448:Tnik APN 3 28621077 missense probably null 0.01
IGL02756:Tnik APN 3 28542030 missense probably damaging 1.00
IGL03332:Tnik APN 3 28666155 missense probably damaging 1.00
Usher UTSW 3 28564097 missense possibly damaging 0.61
R0135:Tnik UTSW 3 28607245 missense possibly damaging 0.67
R0418:Tnik UTSW 3 28570880 nonsense probably null
R0540:Tnik UTSW 3 28650159 missense probably damaging 1.00
R0549:Tnik UTSW 3 28570920 missense possibly damaging 0.87
R0556:Tnik UTSW 3 28625218 missense possibly damaging 0.95
R0586:Tnik UTSW 3 28577361 splice site probably benign
R0607:Tnik UTSW 3 28650159 missense probably damaging 1.00
R0842:Tnik UTSW 3 28594086 missense possibly damaging 0.72
R1068:Tnik UTSW 3 28532975 missense probably damaging 1.00
R1171:Tnik UTSW 3 28532940 missense probably damaging 1.00
R1597:Tnik UTSW 3 28604269 missense probably damaging 1.00
R1638:Tnik UTSW 3 28665740 missense probably damaging 0.99
R1652:Tnik UTSW 3 28604293 missense probably benign 0.22
R1996:Tnik UTSW 3 28665680 missense probably damaging 1.00
R2333:Tnik UTSW 3 28532996 missense probably damaging 1.00
R2426:Tnik UTSW 3 28646681 missense probably damaging 1.00
R2509:Tnik UTSW 3 28667915 missense probably damaging 1.00
R3774:Tnik UTSW 3 28638419 missense probably damaging 0.98
R3775:Tnik UTSW 3 28638419 missense probably damaging 0.98
R4007:Tnik UTSW 3 28604281 missense probably damaging 1.00
R4119:Tnik UTSW 3 28666175 missense probably damaging 1.00
R4209:Tnik UTSW 3 28359065 splice site probably benign
R4441:Tnik UTSW 3 28564097 missense possibly damaging 0.61
R4611:Tnik UTSW 3 28542100 critical splice donor site probably null
R4714:Tnik UTSW 3 28594077 missense possibly damaging 0.53
R4772:Tnik UTSW 3 28607210 missense probably benign 0.09
R4829:Tnik UTSW 3 28539541 intron probably benign
R4839:Tnik UTSW 3 28596075 missense possibly damaging 0.86
R4898:Tnik UTSW 3 28650086 missense probably damaging 1.00
R5029:Tnik UTSW 3 28665844 splice site probably null
R5278:Tnik UTSW 3 28650060 missense probably damaging 1.00
R5307:Tnik UTSW 3 28541972 missense probably damaging 1.00
R5330:Tnik UTSW 3 28542018 missense probably damaging 1.00
R5375:Tnik UTSW 3 28594092 missense probably benign 0.02
R5459:Tnik UTSW 3 28661741 missense probably damaging 1.00
R5708:Tnik UTSW 3 28611971 critical splice donor site probably null
R5749:Tnik UTSW 3 28594092 missense probably benign 0.02
R5751:Tnik UTSW 3 28594092 missense probably benign 0.02
R5780:Tnik UTSW 3 28594092 missense probably benign 0.02
R5837:Tnik UTSW 3 28668053 unclassified probably benign
R5969:Tnik UTSW 3 28620948 missense probably damaging 1.00
R6244:Tnik UTSW 3 28650179 missense probably damaging 1.00
R6273:Tnik UTSW 3 28577500 missense possibly damaging 0.94
R6457:Tnik UTSW 3 28539448 missense probably damaging 1.00
R6464:Tnik UTSW 3 28611970 critical splice donor site probably null
R6473:Tnik UTSW 3 28263643 start codon destroyed probably null 0.93
R6737:Tnik UTSW 3 28596086 missense possibly damaging 0.72
R7049:Tnik UTSW 3 28661704 nonsense probably null
R7267:Tnik UTSW 3 28646627 missense probably damaging 0.99
X0022:Tnik UTSW 3 28667951 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACAGAATATTCTCGAAGTCGCTG -3'
(R):5'- TATCCTCCTGTTTAGCCAGAACAC -3'

Sequencing Primer
(F):5'- TCTCGAAGTCGCTGCAATAATC -3'
(R):5'- GCATAAGCATCCTATGTAAAAGTTTG -3'
Posted On2019-06-26