Incidental Mutation 'R0578:Mtch2'
ID56290
Institutional Source Beutler Lab
Gene Symbol Mtch2
Ensembl Gene ENSMUSG00000027282
Gene Namemitochondrial carrier 2
Synonyms2310034D24Rik, HSPC032, 4930539J07Rik
MMRRC Submission 038768-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0578 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location90847155-90866810 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 90852830 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111467] [ENSMUST00000111468] [ENSMUST00000136872] [ENSMUST00000150232]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000057216
Predicted Effect probably benign
Transcript: ENSMUST00000111467
SMART Domains Protein: ENSMUSP00000107092
Gene: ENSMUSG00000027282

DomainStartEndE-ValueType
Pfam:Mito_carr 109 198 1.9e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111468
Predicted Effect probably benign
Transcript: ENSMUST00000136872
SMART Domains Protein: ENSMUSP00000121851
Gene: ENSMUSG00000027282

DomainStartEndE-ValueType
Pfam:Mito_carr 118 207 3.6e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143773
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144696
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146392
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148936
Predicted Effect probably benign
Transcript: ENSMUST00000150232
SMART Domains Protein: ENSMUSP00000118566
Gene: ENSMUSG00000027282

DomainStartEndE-ValueType
Pfam:Mito_carr 127 215 1.7e-11 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: This gene encodes a member of the SLC25 family of nuclear-encoded transporters that are localized in the inner mitochondrial membrane. Members of this superfamily are involved in many metabolic pathways and cell functions. Genome-wide association studies in human have identified single-nucleotide polymorphisms in several loci associated with obesity. This gene is one such locus, which is highly expressed in white adipose tissue and adipocytes, and thought to play a regulatory role in adipocyte differentiation and biology. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A recent study showed this gene to be an authentic stop codon readthrough target, and that its mRNA can give rise to an additional C-terminally extended isoform by use of an alternative in-frame translation termination codon. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal mesoderm development, disorganized extraembryonic tissue, lack of amnion and chorion formation, decreased embryo size, and lethality at around E7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,059,355 Y56C possibly damaging Het
Abca5 A T 11: 110,276,489 C1500* probably null Het
Acr C G 15: 89,569,475 H72Q probably damaging Het
Adam18 T C 8: 24,641,847 D416G possibly damaging Het
Afap1l2 T A 19: 56,915,782 Y691F probably benign Het
Akna A G 4: 63,370,910 S1259P probably benign Het
Atad2 G A 15: 58,105,568 T525I probably damaging Het
Atp2a1 T G 7: 126,450,143 M576L probably benign Het
B4galt6 T C 18: 20,727,956 probably benign Het
Best3 A G 10: 117,008,999 D353G probably benign Het
Btg3 A T 16: 78,364,946 D125E probably benign Het
C87499 T A 4: 88,634,139 I2F probably benign Het
Cabin1 A T 10: 75,713,610 D1320E probably damaging Het
Cachd1 A C 4: 100,994,842 probably benign Het
Cad T C 5: 31,058,776 V151A probably benign Het
Capns1 A T 7: 30,194,028 probably benign Het
Catsperg2 T A 7: 29,704,691 T860S possibly damaging Het
Ccdc61 T C 7: 18,903,475 T76A probably benign Het
Cdipt T A 7: 126,979,530 probably null Het
Cyp2d12 G A 15: 82,556,383 probably benign Het
Dennd4c C A 4: 86,812,422 P852Q probably damaging Het
Dsg2 G A 18: 20,594,234 V613I probably benign Het
Dusp16 G C 6: 134,718,321 L516V probably damaging Het
Eif2ak4 T G 2: 118,474,991 probably benign Het
Faf2 C T 13: 54,621,845 A2V possibly damaging Het
Gas2l3 A G 10: 89,417,075 I236T probably damaging Het
Gm6605 C A 7: 38,448,275 noncoding transcript Het
Got1 G T 19: 43,515,783 S66R probably benign Het
Gpr149 T A 3: 62,602,689 H335L possibly damaging Het
Hadhb A G 5: 30,178,806 I342M probably benign Het
Helz T A 11: 107,686,400 V1859D unknown Het
Htr1a T A 13: 105,445,087 N278K probably damaging Het
Inppl1 T C 7: 101,831,588 E355G probably damaging Het
Isl2 A G 9: 55,545,035 Y297C probably damaging Het
Kat7 T C 11: 95,291,524 H250R probably benign Het
Klhl30 A T 1: 91,354,352 D225V probably benign Het
Muc4 C A 16: 32,755,690 probably benign Het
Ncoa7 A C 10: 30,701,917 probably null Het
Nuf2 T A 1: 169,510,549 probably benign Het
Olfr767 A G 10: 129,079,193 Y257H probably damaging Het
Olfr994 T C 2: 85,430,673 D52G probably benign Het
Pced1a T A 2: 130,419,843 S297C probably damaging Het
Pi15 A T 1: 17,602,849 K91* probably null Het
Pla2g4e C T 2: 120,244,681 probably benign Het
Plce1 A T 19: 38,777,939 H2136L probably damaging Het
Plec A G 15: 76,176,884 L2973P probably damaging Het
Poln A G 5: 34,014,338 I695T probably damaging Het
R3hdm1 C T 1: 128,231,437 Q950* probably null Het
Rxra C T 2: 27,759,570 A429V probably damaging Het
Scnn1a G A 6: 125,322,244 G96S probably damaging Het
Senp5 T A 16: 31,989,345 T337S possibly damaging Het
Smg9 A G 7: 24,415,043 D269G probably damaging Het
Srsf11 C T 3: 158,012,067 probably benign Het
Tmtc1 C T 6: 148,355,218 probably benign Het
Vmn2r19 T C 6: 123,335,972 V667A probably damaging Het
Other mutations in Mtch2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03390:Mtch2 APN 2 90859550 missense probably benign 0.08
R0543:Mtch2 UTSW 2 90849682 missense possibly damaging 0.81
R1418:Mtch2 UTSW 2 90853015 splice site probably benign
R1996:Mtch2 UTSW 2 90847321 missense possibly damaging 0.74
R4305:Mtch2 UTSW 2 90859483 missense probably benign 0.00
R6268:Mtch2 UTSW 2 90863648 missense probably benign
R6386:Mtch2 UTSW 2 90849395 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- TGGCACTACTGGGAATTGAACCAAAA -3'
(R):5'- AGACCTGGAAGCACAGGATGTATGA -3'

Sequencing Primer
(F):5'- ggaaatagaagcagaagcatcag -3'
(R):5'- ATCCTGGTTCAATCACATGGG -3'
Posted On2013-07-11