Incidental Mutation 'R7237:Tnxb'
ID562932
Institutional Source Beutler Lab
Gene Symbol Tnxb
Ensembl Gene ENSMUSG00000033327
Gene Nametenascin XB
SynonymsTnx, TN-MHC
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7237 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location34670535-34719815 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 34682196 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 995 (L995I)
Ref Sequence ENSEMBL: ENSMUSP00000084661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087399] [ENSMUST00000168533]
Predicted Effect possibly damaging
Transcript: ENSMUST00000087399
AA Change: L995I

PolyPhen 2 Score 0.825 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000084661
Gene: ENSMUSG00000033327
AA Change: L995I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
low complexity region 69 89 N/A INTRINSIC
low complexity region 92 103 N/A INTRINSIC
EGF 173 201 1.59e1 SMART
EGF 204 232 7.41e0 SMART
EGF 235 263 2.64e1 SMART
EGF 266 294 2.64e1 SMART
EGF 297 325 9.13e0 SMART
EGF 328 356 2.07e1 SMART
EGF_like 359 387 3.16e1 SMART
EGF_like 390 418 4.64e1 SMART
EGF_like 421 449 3.29e1 SMART
EGF_like 452 480 7.09e1 SMART
EGF 483 511 1.15e1 SMART
EGF 514 542 1.91e1 SMART
EGF_like 545 573 4.11e1 SMART
EGF 576 604 7.95e0 SMART
EGF 607 635 1.23e1 SMART
EGF_like 638 666 4.93e1 SMART
EGF_like 674 702 5.24e1 SMART
EGF 705 733 2.29e1 SMART
FN3 736 816 4.12e-3 SMART
FN3 827 904 1.21e-9 SMART
FN3 1047 1126 3.97e-5 SMART
FN3 1142 1223 3.62e-8 SMART
low complexity region 1230 1241 N/A INTRINSIC
FN3 1242 1320 2.31e-6 SMART
FN3 1351 1431 8.77e-7 SMART
FN3 1460 1539 3.01e-5 SMART
FN3 1556 1636 2.76e-4 SMART
FN3 1657 1736 5.78e-7 SMART
FN3 1752 1832 4.7e-7 SMART
FN3 1851 1929 1.95e-4 SMART
FN3 1955 2034 4.56e-5 SMART
FN3 2066 2145 2.23e-8 SMART
FN3 2164 2244 7.75e-8 SMART
FN3 2279 2358 8.5e-5 SMART
FN3 2387 2467 2.94e-8 SMART
FN3 2501 2580 1.7e-4 SMART
low complexity region 2588 2598 N/A INTRINSIC
FN3 2607 2687 6.75e-8 SMART
FN3 2716 2795 7.4e-5 SMART
FN3 2822 2902 1.35e-7 SMART
FN3 2931 3010 5.61e-5 SMART
FN3 3026 3106 6.01e-5 SMART
FN3 3120 3199 6.45e-5 SMART
FN3 3214 3293 9.54e-8 SMART
FN3 3316 3396 2.81e-5 SMART
FN3 3416 3502 1.98e-5 SMART
FN3 3518 3596 5.65e-10 SMART
FN3 3607 3682 7.63e-7 SMART
FN3 3695 3770 6.54e-6 SMART
FBG 3787 3997 8.88e-125 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168533
SMART Domains Protein: ENSMUSP00000127487
Gene: ENSMUSG00000033327

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
low complexity region 69 89 N/A INTRINSIC
low complexity region 92 103 N/A INTRINSIC
EGF 173 201 1.59e1 SMART
EGF 204 232 7.41e0 SMART
EGF 235 263 2.64e1 SMART
EGF 266 294 2.64e1 SMART
EGF 297 325 9.13e0 SMART
EGF 328 356 2.07e1 SMART
EGF_like 359 387 3.16e1 SMART
EGF_like 390 418 4.64e1 SMART
EGF_like 421 449 3.29e1 SMART
EGF_like 452 480 7.09e1 SMART
EGF 483 511 1.15e1 SMART
EGF 514 542 1.91e1 SMART
EGF_like 545 573 4.11e1 SMART
EGF 576 604 7.95e0 SMART
EGF 607 635 1.23e1 SMART
EGF_like 638 666 4.93e1 SMART
EGF_like 674 702 5.24e1 SMART
EGF 705 733 2.29e1 SMART
FN3 736 816 4.12e-3 SMART
FN3 827 904 1.21e-9 SMART
FN3 924 1003 3.97e-5 SMART
FN3 1019 1100 3.62e-8 SMART
low complexity region 1107 1118 N/A INTRINSIC
FN3 1119 1197 2.31e-6 SMART
FN3 1228 1308 8.77e-7 SMART
FN3 1337 1416 3.01e-5 SMART
FN3 1433 1513 2.76e-4 SMART
FN3 1534 1613 5.78e-7 SMART
FN3 1629 1709 4.7e-7 SMART
FN3 1728 1806 1.95e-4 SMART
FN3 1832 1911 4.56e-5 SMART
FN3 1943 2022 2.23e-8 SMART
FN3 2051 2130 5.61e-5 SMART
FN3 2146 2226 6.01e-5 SMART
FN3 2240 2319 6.45e-5 SMART
FN3 2334 2413 9.54e-8 SMART
FN3 2436 2516 2.81e-5 SMART
FN3 2536 2622 1.98e-5 SMART
FN3 2638 2716 5.65e-10 SMART
FN3 2727 2802 7.63e-7 SMART
FN3 2815 2890 6.54e-6 SMART
FBG 2907 3117 8.88e-125 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tenascin family of extracellular matrix glycoproteins. The tenascins have anti-adhesive effects, as opposed to fibronectin which is adhesive. This protein is thought to function in matrix maturation during wound healing, and its deficiency has been associated with the connective tissue disorder Ehlers-Danlos syndrome. This gene localizes to the major histocompatibility complex (MHC) class III region on chromosome 6. It is one of four genes in this cluster which have been duplicated. The duplicated copy of this gene is incomplete and is a pseudogene which is transcribed but does not encode a protein. The structure of this gene is unusual in that it overlaps the CREBL1 and CYP21A2 genes at its 5' and 3' ends, respectively. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice have stretchy skin, similar to patients with human Ehlers-Danlos syndrome. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap21 A T 2: 20,849,972 C1536* probably null Het
Armc9 C A 1: 86,164,849 Q169K possibly damaging Het
Aspm T A 1: 139,477,929 M1518K possibly damaging Het
AU018091 A G 7: 3,159,166 I360T probably benign Het
BB014433 C A 8: 15,041,765 V363L probably benign Het
Cacna1g T C 11: 94,437,879 S1071G probably benign Het
Card9 A T 2: 26,356,775 S354T probably benign Het
Ccdc87 A G 19: 4,839,762 N94S probably benign Het
Cdc27 A G 11: 104,517,419 V555A probably benign Het
Coro1a T A 7: 126,700,306 D411V probably benign Het
Cybrd1 GGTCCTGCAC G 2: 71,118,209 probably benign Het
Cyth1 A T 11: 118,185,495 I95N probably damaging Het
Ddx58 T A 4: 40,205,938 I885F probably benign Het
Dnah7b A T 1: 46,139,966 E933V probably damaging Het
Dync2h1 A T 9: 6,993,966 I3968N probably benign Het
Fam126b G A 1: 58,529,948 Q491* probably null Het
Fat3 G A 9: 16,377,214 L338F probably damaging Het
Fcgr3 A G 1: 171,059,301 L18P probably damaging Het
Gbp5 T C 3: 142,507,700 V459A probably benign Het
Gja4 A T 4: 127,312,163 M269K probably benign Het
Gm4787 A G 12: 81,377,668 V572A probably damaging Het
Gys1 A G 7: 45,455,162 D671G probably benign Het
Haspin T C 11: 73,136,886 N459S probably benign Het
Hdac10 G T 15: 89,125,377 Q451K probably benign Het
Hdac9 T C 12: 34,374,140 probably null Het
Hmcn1 A G 1: 150,722,643 V1636A probably damaging Het
Hpca A G 4: 129,118,614 L43P probably damaging Het
Insm1 C A 2: 146,222,528 A88E possibly damaging Het
Itga9 A G 9: 118,636,602 K175E probably benign Het
Kif13a A G 13: 46,809,156 probably null Het
Kif20b T A 19: 34,950,605 L1089H probably damaging Het
Lamp5 A T 2: 136,059,835 H152L probably benign Het
Lrp4 T C 2: 91,473,183 F76L probably benign Het
Magi3 T C 3: 104,027,911 D902G probably damaging Het
Map10 C T 8: 125,671,224 P452L probably benign Het
Mapk6 A G 9: 75,397,613 L174P probably damaging Het
Ndufa4 C T 6: 11,906,019 probably null Het
Nedd4 A T 9: 72,725,064 E393D probably benign Het
Nlrp4b G A 7: 10,715,216 V449I probably benign Het
Nufip2 T A 11: 77,692,770 N503K probably benign Het
Olfr220 C T 1: 174,449,339 R239C probably benign Het
Olfr455 T C 6: 42,538,647 D125G probably damaging Het
P4ha1 A G 10: 59,348,243 T176A probably benign Het
Palm3 A G 8: 84,029,488 K543R probably benign Het
Parvg G A 15: 84,341,356 A302T probably benign Het
Pcdh15 A G 10: 74,584,191 D1227G possibly damaging Het
Pdzd8 C T 19: 59,345,139 G150D probably damaging Het
Pitpnm2 A G 5: 124,125,297 probably null Het
Pld5 T C 1: 176,274,735 Q47R possibly damaging Het
Ppp2r5d T C 17: 46,686,280 S329G possibly damaging Het
Prss56 T C 1: 87,184,915 V144A probably damaging Het
Psg28 A T 7: 18,427,844 Y245N possibly damaging Het
Ptpn3 C T 4: 57,239,625 V302I probably damaging Het
Ptprn2 A G 12: 117,161,727 H627R probably benign Het
Rasgrp2 A T 19: 6,404,808 H226L possibly damaging Het
Rbm20 C T 19: 53,851,499 T973M probably benign Het
Riok2 T A 17: 17,377,783 L44Q probably damaging Het
Rusc1 G T 3: 89,091,498 Q326K possibly damaging Het
Sart3 A T 5: 113,754,246 H397Q possibly damaging Het
Sec31b T A 19: 44,517,708 T920S probably damaging Het
Serpinb13 A G 1: 106,998,949 E225G probably damaging Het
Slc25a47 T C 12: 108,855,460 L165P probably damaging Het
Slc2a10 G A 2: 165,515,277 V286I probably benign Het
Slc39a13 G T 2: 91,065,634 T174N probably benign Het
Slc7a13 T A 4: 19,839,364 N322K probably benign Het
Stk38 T C 17: 28,974,646 T326A possibly damaging Het
Sult1a1 T C 7: 126,673,450 M244V probably benign Het
Tas2r144 C T 6: 42,215,866 T180I probably damaging Het
Tbc1d12 T A 19: 38,898,902 M366K probably benign Het
Terb1 T C 8: 104,495,327 I147V possibly damaging Het
Tldc1 C T 8: 119,762,315 G410S probably damaging Het
Tmem5 A T 10: 122,081,618 L330* probably null Het
Tnik T C 3: 28,638,419 Y820H probably damaging Het
Trim34b A G 7: 104,329,587 T14A possibly damaging Het
Urb1 T C 16: 90,791,166 E418G probably damaging Het
Vmn1r12 T A 6: 57,159,565 C216S possibly damaging Het
Vmn2r90 T A 17: 17,703,987 V16E possibly damaging Het
Vps11 A T 9: 44,354,506 V492D probably damaging Het
Zc3h14 T A 12: 98,780,149 M539K probably benign Het
Zfp871 A T 17: 32,775,315 H295Q probably damaging Het
Other mutations in Tnxb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Tnxb APN 17 34685629 missense probably damaging 1.00
IGL00424:Tnxb APN 17 34714692 missense probably damaging 1.00
IGL00486:Tnxb APN 17 34692382 missense probably damaging 1.00
IGL00952:Tnxb APN 17 34713128 missense probably damaging 1.00
IGL00974:Tnxb APN 17 34718733 critical splice donor site probably null
IGL01017:Tnxb APN 17 34693808 missense probably damaging 0.98
IGL01082:Tnxb APN 17 34714610 missense probably damaging 0.97
IGL01397:Tnxb APN 17 34714673 missense probably damaging 0.99
IGL01473:Tnxb APN 17 34685701 missense probably damaging 0.99
IGL01642:Tnxb APN 17 34718514 missense probably damaging 1.00
IGL01774:Tnxb APN 17 34688839 missense probably damaging 1.00
IGL01971:Tnxb APN 17 34672297 missense probably damaging 1.00
IGL02016:Tnxb APN 17 34672275 missense probably damaging 0.98
IGL02160:Tnxb APN 17 34714745 missense probably benign 0.01
IGL02473:Tnxb APN 17 34717762 missense probably damaging 1.00
IGL02666:Tnxb APN 17 34684939 missense probably benign 0.20
IGL02831:Tnxb APN 17 34703571 missense possibly damaging 0.93
IGL02838:Tnxb APN 17 34689632 missense possibly damaging 0.74
IGL02965:Tnxb APN 17 34709654 missense possibly damaging 0.93
IGL03155:Tnxb APN 17 34713595 missense probably damaging 1.00
IGL03194:Tnxb APN 17 34695947 nonsense probably null
IGL03215:Tnxb APN 17 34692525 missense possibly damaging 0.66
IGL03256:Tnxb APN 17 34688720 missense probably damaging 1.00
E0370:Tnxb UTSW 17 34678943 missense probably damaging 1.00
R0006:Tnxb UTSW 17 34682292 missense probably benign 0.07
R0049:Tnxb UTSW 17 34709568 missense possibly damaging 0.93
R0050:Tnxb UTSW 17 34673325 missense probably damaging 1.00
R0233:Tnxb UTSW 17 34699033 missense probably benign 0.32
R0233:Tnxb UTSW 17 34699033 missense probably benign 0.32
R0311:Tnxb UTSW 17 34716984 missense probably damaging 0.97
R0326:Tnxb UTSW 17 34698179 missense probably benign 0.32
R0387:Tnxb UTSW 17 34683574 missense probably benign 0.30
R0396:Tnxb UTSW 17 34671733 missense probably damaging 1.00
R0511:Tnxb UTSW 17 34718245 missense probably damaging 0.96
R0540:Tnxb UTSW 17 34671918 missense probably damaging 1.00
R0563:Tnxb UTSW 17 34716947 missense probably benign 0.05
R0575:Tnxb UTSW 17 34717206 missense possibly damaging 0.91
R0586:Tnxb UTSW 17 34672144 missense probably damaging 1.00
R0607:Tnxb UTSW 17 34671918 missense probably damaging 1.00
R0622:Tnxb UTSW 17 34718729 missense probably damaging 1.00
R0624:Tnxb UTSW 17 34683548 missense probably damaging 1.00
R0709:Tnxb UTSW 17 34689354 missense probably damaging 1.00
R0898:Tnxb UTSW 17 34670745 missense probably damaging 1.00
R0970:Tnxb UTSW 17 34698943 missense possibly damaging 0.85
R0972:Tnxb UTSW 17 34685143 missense probably damaging 1.00
R1118:Tnxb UTSW 17 34685043 missense probably damaging 1.00
R1119:Tnxb UTSW 17 34685043 missense probably damaging 1.00
R1226:Tnxb UTSW 17 34688929 missense probably damaging 1.00
R1296:Tnxb UTSW 17 34671577 missense probably damaging 1.00
R1297:Tnxb UTSW 17 34710166 missense probably damaging 0.96
R1349:Tnxb UTSW 17 34710293 missense possibly damaging 0.67
R1356:Tnxb UTSW 17 34695472 missense possibly damaging 0.53
R1372:Tnxb UTSW 17 34710293 missense possibly damaging 0.67
R1521:Tnxb UTSW 17 34711503 missense probably damaging 1.00
R1522:Tnxb UTSW 17 34718638 missense probably damaging 1.00
R1532:Tnxb UTSW 17 34710830 missense probably damaging 1.00
R1735:Tnxb UTSW 17 34717970 missense probably damaging 1.00
R1778:Tnxb UTSW 17 34683574 missense probably benign 0.30
R1802:Tnxb UTSW 17 34703889 missense probably damaging 0.98
R1824:Tnxb UTSW 17 34692333 nonsense probably null
R1838:Tnxb UTSW 17 34678910 missense probably damaging 0.96
R1863:Tnxb UTSW 17 34670874 missense probably damaging 1.00
R1865:Tnxb UTSW 17 34703457 nonsense probably null
R1867:Tnxb UTSW 17 34671847 missense probably damaging 1.00
R1883:Tnxb UTSW 17 34689565 missense probably benign 0.01
R1884:Tnxb UTSW 17 34689565 missense probably benign 0.01
R1889:Tnxb UTSW 17 34695825 missense probably damaging 0.97
R1969:Tnxb UTSW 17 34679081 missense probably benign 0.20
R1989:Tnxb UTSW 17 34683377 missense probably benign 0.08
R1989:Tnxb UTSW 17 34693885 missense probably damaging 1.00
R1991:Tnxb UTSW 17 34671904 missense probably damaging 1.00
R1991:Tnxb UTSW 17 34682251 missense probably damaging 1.00
R1992:Tnxb UTSW 17 34671904 missense probably damaging 1.00
R2001:Tnxb UTSW 17 34692579 missense possibly damaging 0.82
R2018:Tnxb UTSW 17 34671750 missense probably benign 0.04
R2030:Tnxb UTSW 17 34718469 missense probably damaging 1.00
R2037:Tnxb UTSW 17 34699205 missense probably damaging 1.00
R2103:Tnxb UTSW 17 34682251 missense probably damaging 1.00
R2116:Tnxb UTSW 17 34672227 missense probably damaging 1.00
R2206:Tnxb UTSW 17 34709417 missense possibly damaging 0.86
R2207:Tnxb UTSW 17 34709417 missense possibly damaging 0.86
R2215:Tnxb UTSW 17 34704140 missense possibly damaging 0.93
R2413:Tnxb UTSW 17 34718278 missense probably damaging 0.99
R2680:Tnxb UTSW 17 34703620 missense possibly damaging 0.51
R2910:Tnxb UTSW 17 34672450 missense probably damaging 1.00
R2984:Tnxb UTSW 17 34678662 nonsense probably null
R3120:Tnxb UTSW 17 34692355 missense possibly damaging 0.86
R3429:Tnxb UTSW 17 34672631 nonsense probably null
R3429:Tnxb UTSW 17 34703587 missense probably damaging 0.98
R3552:Tnxb UTSW 17 34718721 missense probably damaging 1.00
R3698:Tnxb UTSW 17 34690433 critical splice donor site probably null
R3720:Tnxb UTSW 17 34712964 missense possibly damaging 0.95
R3841:Tnxb UTSW 17 34698923 missense possibly damaging 0.72
R3848:Tnxb UTSW 17 34690395 missense possibly damaging 0.82
R3886:Tnxb UTSW 17 34718911 missense probably damaging 1.00
R4074:Tnxb UTSW 17 34671871 missense probably benign 0.22
R4159:Tnxb UTSW 17 34711517 missense probably damaging 0.99
R4160:Tnxb UTSW 17 34711517 missense probably damaging 0.99
R4161:Tnxb UTSW 17 34711517 missense probably damaging 0.99
R4181:Tnxb UTSW 17 34709454 missense possibly damaging 0.93
R4210:Tnxb UTSW 17 34710977 missense possibly damaging 0.84
R4275:Tnxb UTSW 17 34698231 missense probably damaging 0.98
R4329:Tnxb UTSW 17 34693864 missense probably damaging 1.00
R4394:Tnxb UTSW 17 34678662 nonsense probably null
R4395:Tnxb UTSW 17 34678662 nonsense probably null
R4397:Tnxb UTSW 17 34678662 nonsense probably null
R4540:Tnxb UTSW 17 34703335 missense possibly damaging 0.86
R4673:Tnxb UTSW 17 34672540 missense probably damaging 0.99
R4719:Tnxb UTSW 17 34689420 missense probably damaging 1.00
R4725:Tnxb UTSW 17 34699067 missense probably damaging 0.99
R4753:Tnxb UTSW 17 34695935 missense possibly damaging 0.71
R4777:Tnxb UTSW 17 34671943 missense probably damaging 1.00
R4837:Tnxb UTSW 17 34718007 missense probably damaging 0.98
R4898:Tnxb UTSW 17 34695592 missense possibly damaging 0.95
R4938:Tnxb UTSW 17 34713632 missense probably damaging 1.00
R5044:Tnxb UTSW 17 34717483 missense probably damaging 1.00
R5100:Tnxb UTSW 17 34710928 missense probably damaging 0.99
R5223:Tnxb UTSW 17 34704078 missense possibly damaging 0.51
R5269:Tnxb UTSW 17 34703608 missense possibly damaging 0.95
R5333:Tnxb UTSW 17 34690231 missense probably damaging 1.00
R5454:Tnxb UTSW 17 34709625 missense possibly damaging 0.71
R5470:Tnxb UTSW 17 34716973 missense probably null 1.00
R5475:Tnxb UTSW 17 34689593 missense probably damaging 1.00
R5574:Tnxb UTSW 17 34711024 missense probably benign
R5596:Tnxb UTSW 17 34688804 missense probably damaging 1.00
R5599:Tnxb UTSW 17 34690202 missense probably damaging 1.00
R5599:Tnxb UTSW 17 34690205 missense probably benign 0.22
R5615:Tnxb UTSW 17 34683418 missense probably damaging 1.00
R5620:Tnxb UTSW 17 34717530 nonsense probably null
R5625:Tnxb UTSW 17 34685211 missense probably benign 0.30
R5734:Tnxb UTSW 17 34698910 missense possibly damaging 0.53
R5896:Tnxb UTSW 17 34672152 missense probably damaging 1.00
R5961:Tnxb UTSW 17 34718635 missense probably damaging 1.00
R5974:Tnxb UTSW 17 34685707 missense probably damaging 1.00
R6091:Tnxb UTSW 17 34710364 missense probably damaging 0.98
R6134:Tnxb UTSW 17 34672012 missense probably damaging 0.96
R6325:Tnxb UTSW 17 34692424 missense probably damaging 1.00
R6358:Tnxb UTSW 17 34678994 missense probably damaging 0.98
R6362:Tnxb UTSW 17 34694388 missense probably damaging 1.00
R6432:Tnxb UTSW 17 34717917 missense probably damaging 1.00
R6461:Tnxb UTSW 17 34671898 missense probably damaging 1.00
R6467:Tnxb UTSW 17 34693924 missense probably damaging 1.00
R6476:Tnxb UTSW 17 34690192 missense probably damaging 0.98
R6477:Tnxb UTSW 17 34719539 missense probably damaging 1.00
R6631:Tnxb UTSW 17 34718248 missense probably damaging 1.00
R6774:Tnxb UTSW 17 34709632 nonsense probably null
R6787:Tnxb UTSW 17 34710736 missense probably benign 0.02
R6805:Tnxb UTSW 17 34698153 missense possibly damaging 0.93
R6860:Tnxb UTSW 17 34713157 missense probably damaging 0.99
R6883:Tnxb UTSW 17 34718519 missense probably damaging 1.00
R7049:Tnxb UTSW 17 34717268 critical splice donor site probably null
R7107:Tnxb UTSW 17 34671340 missense unknown
R7172:Tnxb UTSW 17 34696020 missense probably damaging 1.00
R7206:Tnxb UTSW 17 34704101 missense possibly damaging 0.71
R7219:Tnxb UTSW 17 34679065 missense probably benign 0.08
R7257:Tnxb UTSW 17 34716501 missense probably benign 0.44
R7269:Tnxb UTSW 17 34695454 missense probably damaging 1.00
R7302:Tnxb UTSW 17 34678901 missense probably benign 0.41
X0004:Tnxb UTSW 17 34703415 missense possibly damaging 0.71
X0010:Tnxb UTSW 17 34671934 missense probably damaging 1.00
X0019:Tnxb UTSW 17 34694189 missense possibly damaging 0.51
X0063:Tnxb UTSW 17 34703508 missense probably damaging 0.98
X0064:Tnxb UTSW 17 34694032 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGAGGCTACTGATGAGCC -3'
(R):5'- CCTACCTCTAGAGTCCTGAGATGG -3'

Sequencing Primer
(F):5'- AGGCTACTGATGAGCCTCCTC -3'
(R):5'- TAGAGTCCTGAGATGGCCCCAG -3'
Posted On2019-06-26