Incidental Mutation 'R0578:C87499'
ID56299
Institutional Source Beutler Lab
Gene Symbol C87499
Ensembl Gene ENSMUSG00000038330
Gene Nameexpressed sequence C87499
Synonyms
MMRRC Submission 038768-MU
Accession Numbers

Ncbi RefSeq:NM_198663.3; MGI:2140706

Is this an essential gene? Possibly non essential (E-score: 0.259) question?
Stock #R0578 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location88627320-88634411 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 88634139 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 2 (I2F)
Ref Sequence ENSEMBL: ENSMUSP00000102761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053304] [ENSMUST00000107142] [ENSMUST00000107143] [ENSMUST00000134155] [ENSMUST00000156062]
Predicted Effect probably benign
Transcript: ENSMUST00000053304
AA Change: I2F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000056691
Gene: ENSMUSG00000038330
AA Change: I2F

DomainStartEndE-ValueType
SCOP:d1a4ya_ 223 425 4e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107142
AA Change: I2F

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000107143
AA Change: I2F

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000134155
Predicted Effect probably benign
Transcript: ENSMUST00000156062
Meta Mutation Damage Score 0.1612 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 100% (53/53)
Allele List at MGI

All alleles(3) : Targeted(2) Gene trapped(1)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,059,355 Y56C possibly damaging Het
Abca5 A T 11: 110,276,489 C1500* probably null Het
Acr C G 15: 89,569,475 H72Q probably damaging Het
Adam18 T C 8: 24,641,847 D416G possibly damaging Het
Afap1l2 T A 19: 56,915,782 Y691F probably benign Het
Akna A G 4: 63,370,910 S1259P probably benign Het
Atad2 G A 15: 58,105,568 T525I probably damaging Het
Atp2a1 T G 7: 126,450,143 M576L probably benign Het
B4galt6 T C 18: 20,727,956 probably benign Het
Best3 A G 10: 117,008,999 D353G probably benign Het
Btg3 A T 16: 78,364,946 D125E probably benign Het
Cabin1 A T 10: 75,713,610 D1320E probably damaging Het
Cachd1 A C 4: 100,994,842 probably benign Het
Cad T C 5: 31,058,776 V151A probably benign Het
Capns1 A T 7: 30,194,028 probably benign Het
Catsperg2 T A 7: 29,704,691 T860S possibly damaging Het
Ccdc61 T C 7: 18,903,475 T76A probably benign Het
Cdipt T A 7: 126,979,530 probably null Het
Cyp2d12 G A 15: 82,556,383 probably benign Het
Dennd4c C A 4: 86,812,422 P852Q probably damaging Het
Dsg2 G A 18: 20,594,234 V613I probably benign Het
Dusp16 G C 6: 134,718,321 L516V probably damaging Het
Eif2ak4 T G 2: 118,474,991 probably benign Het
Faf2 C T 13: 54,621,845 A2V possibly damaging Het
Gas2l3 A G 10: 89,417,075 I236T probably damaging Het
Gm6605 C A 7: 38,448,275 noncoding transcript Het
Got1 G T 19: 43,515,783 S66R probably benign Het
Gpr149 T A 3: 62,602,689 H335L possibly damaging Het
Hadhb A G 5: 30,178,806 I342M probably benign Het
Helz T A 11: 107,686,400 V1859D unknown Het
Htr1a T A 13: 105,445,087 N278K probably damaging Het
Inppl1 T C 7: 101,831,588 E355G probably damaging Het
Isl2 A G 9: 55,545,035 Y297C probably damaging Het
Kat7 T C 11: 95,291,524 H250R probably benign Het
Klhl30 A T 1: 91,354,352 D225V probably benign Het
Mtch2 T C 2: 90,852,830 probably benign Het
Muc4 C A 16: 32,755,690 probably benign Het
Ncoa7 A C 10: 30,701,917 probably null Het
Nuf2 T A 1: 169,510,549 probably benign Het
Olfr767 A G 10: 129,079,193 Y257H probably damaging Het
Olfr994 T C 2: 85,430,673 D52G probably benign Het
Pced1a T A 2: 130,419,843 S297C probably damaging Het
Pi15 A T 1: 17,602,849 K91* probably null Het
Pla2g4e C T 2: 120,244,681 probably benign Het
Plce1 A T 19: 38,777,939 H2136L probably damaging Het
Plec A G 15: 76,176,884 L2973P probably damaging Het
Poln A G 5: 34,014,338 I695T probably damaging Het
R3hdm1 C T 1: 128,231,437 Q950* probably null Het
Rxra C T 2: 27,759,570 A429V probably damaging Het
Scnn1a G A 6: 125,322,244 G96S probably damaging Het
Senp5 T A 16: 31,989,345 T337S possibly damaging Het
Smg9 A G 7: 24,415,043 D269G probably damaging Het
Srsf11 C T 3: 158,012,067 probably benign Het
Tmtc1 C T 6: 148,355,218 probably benign Het
Vmn2r19 T C 6: 123,335,972 V667A probably damaging Het
Other mutations in C87499
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:C87499 APN 4 88629070 missense probably benign 0.43
IGL00229:C87499 APN 4 88629053 missense probably damaging 0.99
IGL01938:C87499 APN 4 88629363 missense possibly damaging 0.90
IGL02321:C87499 APN 4 88630103 missense probably benign 0.33
IGL02351:C87499 APN 4 88627890 missense probably damaging 1.00
IGL02358:C87499 APN 4 88627890 missense probably damaging 1.00
P0005:C87499 UTSW 4 88627950 missense probably damaging 1.00
R0521:C87499 UTSW 4 88629322 missense probably damaging 0.96
R0600:C87499 UTSW 4 88629299 missense probably damaging 1.00
R0750:C87499 UTSW 4 88627668 missense probably benign 0.01
R1483:C87499 UTSW 4 88628834 missense probably damaging 1.00
R1502:C87499 UTSW 4 88628032 missense probably benign 0.00
R1911:C87499 UTSW 4 88630072 missense possibly damaging 0.93
R2204:C87499 UTSW 4 88628118 missense probably damaging 0.99
R2507:C87499 UTSW 4 88629211 missense possibly damaging 0.89
R2512:C87499 UTSW 4 88628958 missense probably damaging 0.99
R4299:C87499 UTSW 4 88628182 missense probably damaging 0.97
R4498:C87499 UTSW 4 88628892 unclassified probably null
R4656:C87499 UTSW 4 88629965 missense probably benign 0.41
R4787:C87499 UTSW 4 88629213 nonsense probably null
R4823:C87499 UTSW 4 88629215 missense probably damaging 1.00
R4885:C87499 UTSW 4 88627982 missense possibly damaging 0.50
R4948:C87499 UTSW 4 88628948 missense probably damaging 1.00
R4967:C87499 UTSW 4 88629195 missense probably damaging 1.00
R5229:C87499 UTSW 4 88630135 missense possibly damaging 0.92
R5426:C87499 UTSW 4 88629410 intron probably benign
R5520:C87499 UTSW 4 88630040 missense probably damaging 1.00
R5574:C87499 UTSW 4 88628043 missense probably benign 0.10
R5596:C87499 UTSW 4 88630055 missense probably damaging 1.00
R6282:C87499 UTSW 4 88630054 missense probably damaging 1.00
R6366:C87499 UTSW 4 88628865 missense probably damaging 0.99
R6808:C87499 UTSW 4 88630054 missense probably damaging 1.00
R6866:C87499 UTSW 4 88627740 missense probably damaging 1.00
R7105:C87499 UTSW 4 88630102 missense probably damaging 0.98
R7117:C87499 UTSW 4 88628958 missense probably damaging 0.99
R7319:C87499 UTSW 4 88629947 missense probably benign 0.25
R7345:C87499 UTSW 4 88628179 missense possibly damaging 0.88
R7399:C87499 UTSW 4 88627965 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCCAGGCAATCTTATGTGGAGAGA -3'
(R):5'- TCTGCCGAGGACAGACTGAGGA -3'

Sequencing Primer
(F):5'- ATCTCATCTCAAAATAGAAGAACCAG -3'
(R):5'- CCTGAACCACTTGGCTTAAATG -3'
Posted On2013-07-11