Incidental Mutation 'R0578:Vmn2r19'
ID56304
Institutional Source Beutler Lab
Gene Symbol Vmn2r19
Ensembl Gene ENSMUSG00000091260
Gene Namevomeronasal 2, receptor 19
SynonymsEG232358
MMRRC Submission 038768-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R0578 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location123308333-123336537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123335972 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 667 (V667A)
Ref Sequence ENSEMBL: ENSMUSP00000073604 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073948]
Predicted Effect probably damaging
Transcript: ENSMUST00000073948
AA Change: V667A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000073604
Gene: ENSMUSG00000091260
AA Change: V667A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:ANF_receptor 81 476 2.9e-35 PFAM
Pfam:NCD3G 518 571 8.3e-23 PFAM
Pfam:7tm_3 603 839 7.2e-52 PFAM
Meta Mutation Damage Score 0.0236 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,059,355 Y56C possibly damaging Het
Abca5 A T 11: 110,276,489 C1500* probably null Het
Acr C G 15: 89,569,475 H72Q probably damaging Het
Adam18 T C 8: 24,641,847 D416G possibly damaging Het
Afap1l2 T A 19: 56,915,782 Y691F probably benign Het
Akna A G 4: 63,370,910 S1259P probably benign Het
Atad2 G A 15: 58,105,568 T525I probably damaging Het
Atp2a1 T G 7: 126,450,143 M576L probably benign Het
B4galt6 T C 18: 20,727,956 probably benign Het
Best3 A G 10: 117,008,999 D353G probably benign Het
Btg3 A T 16: 78,364,946 D125E probably benign Het
C87499 T A 4: 88,634,139 I2F probably benign Het
Cabin1 A T 10: 75,713,610 D1320E probably damaging Het
Cachd1 A C 4: 100,994,842 probably benign Het
Cad T C 5: 31,058,776 V151A probably benign Het
Capns1 A T 7: 30,194,028 probably benign Het
Catsperg2 T A 7: 29,704,691 T860S possibly damaging Het
Ccdc61 T C 7: 18,903,475 T76A probably benign Het
Cdipt T A 7: 126,979,530 probably null Het
Cyp2d12 G A 15: 82,556,383 probably benign Het
Dennd4c C A 4: 86,812,422 P852Q probably damaging Het
Dsg2 G A 18: 20,594,234 V613I probably benign Het
Dusp16 G C 6: 134,718,321 L516V probably damaging Het
Eif2ak4 T G 2: 118,474,991 probably benign Het
Faf2 C T 13: 54,621,845 A2V possibly damaging Het
Gas2l3 A G 10: 89,417,075 I236T probably damaging Het
Gm6605 C A 7: 38,448,275 noncoding transcript Het
Got1 G T 19: 43,515,783 S66R probably benign Het
Gpr149 T A 3: 62,602,689 H335L possibly damaging Het
Hadhb A G 5: 30,178,806 I342M probably benign Het
Helz T A 11: 107,686,400 V1859D unknown Het
Htr1a T A 13: 105,445,087 N278K probably damaging Het
Inppl1 T C 7: 101,831,588 E355G probably damaging Het
Isl2 A G 9: 55,545,035 Y297C probably damaging Het
Kat7 T C 11: 95,291,524 H250R probably benign Het
Klhl30 A T 1: 91,354,352 D225V probably benign Het
Mtch2 T C 2: 90,852,830 probably benign Het
Muc4 C A 16: 32,755,690 probably benign Het
Ncoa7 A C 10: 30,701,917 probably null Het
Nuf2 T A 1: 169,510,549 probably benign Het
Olfr767 A G 10: 129,079,193 Y257H probably damaging Het
Olfr994 T C 2: 85,430,673 D52G probably benign Het
Pced1a T A 2: 130,419,843 S297C probably damaging Het
Pi15 A T 1: 17,602,849 K91* probably null Het
Pla2g4e C T 2: 120,244,681 probably benign Het
Plce1 A T 19: 38,777,939 H2136L probably damaging Het
Plec A G 15: 76,176,884 L2973P probably damaging Het
Poln A G 5: 34,014,338 I695T probably damaging Het
R3hdm1 C T 1: 128,231,437 Q950* probably null Het
Rxra C T 2: 27,759,570 A429V probably damaging Het
Scnn1a G A 6: 125,322,244 G96S probably damaging Het
Senp5 T A 16: 31,989,345 T337S possibly damaging Het
Smg9 A G 7: 24,415,043 D269G probably damaging Het
Srsf11 C T 3: 158,012,067 probably benign Het
Tmtc1 C T 6: 148,355,218 probably benign Het
Other mutations in Vmn2r19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01407:Vmn2r19 APN 6 123329867 missense possibly damaging 0.92
IGL02294:Vmn2r19 APN 6 123329978 missense probably benign 0.19
IGL02442:Vmn2r19 APN 6 123309662 missense possibly damaging 0.94
IGL02871:Vmn2r19 APN 6 123336083 missense probably damaging 1.00
H8562:Vmn2r19 UTSW 6 123315902 missense possibly damaging 0.82
R0025:Vmn2r19 UTSW 6 123331547 missense probably benign 0.01
R0389:Vmn2r19 UTSW 6 123335986 missense possibly damaging 0.53
R0402:Vmn2r19 UTSW 6 123336182 missense probably damaging 1.00
R0411:Vmn2r19 UTSW 6 123309744 missense probably damaging 0.98
R0554:Vmn2r19 UTSW 6 123336143 missense probably damaging 0.99
R1102:Vmn2r19 UTSW 6 123336173 missense probably benign 0.28
R1652:Vmn2r19 UTSW 6 123315697 missense possibly damaging 0.68
R1663:Vmn2r19 UTSW 6 123336452 missense probably benign 0.11
R1817:Vmn2r19 UTSW 6 123330052 missense possibly damaging 0.80
R1866:Vmn2r19 UTSW 6 123331638 critical splice donor site probably null
R1928:Vmn2r19 UTSW 6 123331630 missense probably damaging 1.00
R1997:Vmn2r19 UTSW 6 123315921 missense probably damaging 0.98
R2013:Vmn2r19 UTSW 6 123315995 missense probably benign 0.01
R2015:Vmn2r19 UTSW 6 123315995 missense probably benign 0.01
R2088:Vmn2r19 UTSW 6 123335836 missense probably damaging 1.00
R2126:Vmn2r19 UTSW 6 123316074 missense possibly damaging 0.82
R2128:Vmn2r19 UTSW 6 123308330 unclassified probably null
R2256:Vmn2r19 UTSW 6 123329886 missense probably benign 0.20
R2517:Vmn2r19 UTSW 6 123329978 missense probably benign 0.19
R3753:Vmn2r19 UTSW 6 123315589 missense possibly damaging 0.80
R3817:Vmn2r19 UTSW 6 123309642 missense probably damaging 1.00
R3929:Vmn2r19 UTSW 6 123315628 missense probably benign 0.01
R3934:Vmn2r19 UTSW 6 123315669 missense probably damaging 1.00
R4232:Vmn2r19 UTSW 6 123329912 missense probably benign
R4574:Vmn2r19 UTSW 6 123315980 missense probably benign 0.01
R4886:Vmn2r19 UTSW 6 123309841 missense probably benign 0.05
R4995:Vmn2r19 UTSW 6 123329910 missense probably benign 0.00
R5107:Vmn2r19 UTSW 6 123309643 nonsense probably null
R5232:Vmn2r19 UTSW 6 123335957 missense probably benign
R6102:Vmn2r19 UTSW 6 123329948 missense probably damaging 1.00
R6105:Vmn2r19 UTSW 6 123316095 missense possibly damaging 0.70
R6280:Vmn2r19 UTSW 6 123336253 missense probably benign
R6393:Vmn2r19 UTSW 6 123316153 missense possibly damaging 0.80
R6502:Vmn2r19 UTSW 6 123316108 missense possibly damaging 0.68
R6617:Vmn2r19 UTSW 6 123336535 makesense probably null
R6742:Vmn2r19 UTSW 6 123329958 missense possibly damaging 0.90
X0058:Vmn2r19 UTSW 6 123308349 missense probably benign 0.00
Z1088:Vmn2r19 UTSW 6 123308339 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCGGGACACACCCATTGTTAGAGC -3'
(R):5'- AAGGTGGACCCCTCATTACACCAG -3'

Sequencing Primer
(F):5'- GGCCAAACTAGAACAGTCACT -3'
(R):5'- GAGGATGATTTGCCCAAACTCTG -3'
Posted On2013-07-11