Incidental Mutation 'R7239:Ift74'
ID563060
Institutional Source Beutler Lab
Gene Symbol Ift74
Ensembl Gene ENSMUSG00000028576
Gene Nameintraflagellar transport 74
SynonymsCmg1, 1700029H06Rik, Ccdc2, b2b796Clo
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_026319.2; MGI: 1914944

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7239 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location94614491-94693229 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94652950 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 204 (V204A)
Ref Sequence ENSEMBL: ENSMUSP00000102721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030311] [ENSMUST00000053419] [ENSMUST00000107101] [ENSMUST00000107104]
Predicted Effect probably benign
Transcript: ENSMUST00000030311
AA Change: V204A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000030311
Gene: ENSMUSG00000028576
AA Change: V204A

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
low complexity region 47 62 N/A INTRINSIC
coiled coil region 98 271 N/A INTRINSIC
coiled coil region 302 382 N/A INTRINSIC
coiled coil region 430 490 N/A INTRINSIC
coiled coil region 512 546 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000053419
SMART Domains Protein: ENSMUSP00000056094
Gene: ENSMUSG00000049799

DomainStartEndE-ValueType
LRR 69 93 3.36e2 SMART
LRR 94 117 4.32e0 SMART
LRR 118 141 1.71e1 SMART
LRR 142 166 1.09e2 SMART
LRRCT 174 225 1.24e-6 SMART
Pfam:LRR19-TM 250 364 8.1e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107101
SMART Domains Protein: ENSMUSP00000102718
Gene: ENSMUSG00000049799

DomainStartEndE-ValueType
LRR 69 93 3.36e2 SMART
LRR 94 117 4.32e0 SMART
LRR 118 141 1.71e1 SMART
LRR 142 166 1.09e2 SMART
LRRCT 174 225 1.24e-6 SMART
Pfam:LRR19-TM 245 364 9.3e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107104
AA Change: V204A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102721
Gene: ENSMUSG00000028576
AA Change: V204A

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
low complexity region 47 62 N/A INTRINSIC
coiled coil region 98 271 N/A INTRINSIC
coiled coil region 302 352 N/A INTRINSIC
Meta Mutation Damage Score 0.068 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 99% (76/77)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit complex congenital heart disease associated with heterotaxy. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Targeted(2) Gene trapped(21)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510009E07Rik A G 16: 21,653,518 V144A probably damaging Het
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Abca5 A T 11: 110,326,704 Y109N possibly damaging Het
Abcb5 T C 12: 118,928,725 Q433R probably benign Het
Adamts7 G A 9: 90,186,557 probably null Het
Adgrv1 T C 13: 81,476,612 D3746G possibly damaging Het
Arhgap29 C T 3: 121,988,950 S159L probably benign Het
Arhgap5 T A 12: 52,517,376 C377S probably benign Het
Atp1a3 G A 7: 25,000,704 P77L probably damaging Het
B4galt1 T C 4: 40,812,754 D257G probably damaging Het
Bin1 T A 18: 32,406,171 N52K probably damaging Het
Catsperg2 A G 7: 29,710,082 M562T probably benign Het
Ccdc33 G A 9: 58,032,909 Q713* probably null Het
Cd96 A T 16: 46,109,114 L156Q probably damaging Het
Clpb A G 7: 101,711,455 T231A probably damaging Het
Dnmt3a A T 12: 3,872,850 Q151L probably benign Het
Dock2 C T 11: 34,231,677 V1629M probably benign Het
Edem1 G A 6: 108,854,380 D601N probably benign Het
Eno2 C T 6: 124,768,265 V20M probably damaging Het
Eny2 A C 15: 44,433,854 D52A probably benign Het
Esp36 T C 17: 38,417,241 R93G possibly damaging Het
Fam227a A G 15: 79,634,062 probably null Het
Fat4 C A 3: 38,983,840 H3880Q possibly damaging Het
Fbxw24 A T 9: 109,605,530 V334E possibly damaging Het
Flrt1 T C 19: 7,095,964 Q406R probably benign Het
Frmpd2 A G 14: 33,552,077 N1092S probably benign Het
Gm904 C A 13: 50,645,251 T82K probably benign Het
Gnas G C 2: 174,298,615 G252R unknown Het
Gpatch2l A G 12: 86,260,575 probably null Het
Hist1h2ac A T 13: 23,683,610 I103N probably damaging Het
Ikzf4 A G 10: 128,641,244 L119P probably damaging Het
Ing3 G A 6: 21,952,194 E56K probably damaging Het
Klhl25 T C 7: 75,866,768 I474T probably benign Het
Klhl5 T C 5: 65,161,186 V556A probably damaging Het
Krt14 A T 11: 100,204,255 M382K probably benign Het
Lmcd1 T C 6: 112,315,784 V199A possibly damaging Het
Lpcat4 T A 2: 112,242,707 F200I possibly damaging Het
Lrp1b T C 2: 41,004,713 T2282A Het
Lrrk1 T C 7: 66,262,155 T1886A probably benign Het
Meis2 T C 2: 116,059,003 probably null Het
Mki67 C T 7: 135,700,176 R1043K possibly damaging Het
Myct1 G T 10: 5,604,601 R156L possibly damaging Het
Nckap5l G T 15: 99,426,209 H804Q probably damaging Het
Ndst3 T G 3: 123,606,906 E450D probably damaging Het
Nipbl A T 15: 8,292,135 probably null Het
Npy A G 6: 49,823,607 N4D probably benign Het
Olfr855 A T 9: 19,585,191 Y218F probably damaging Het
Osgin2 T C 4: 16,008,748 S18G probably benign Het
Pcdha9 T G 18: 36,998,498 F207V probably benign Het
Pcdhb13 A T 18: 37,444,644 I692F probably damaging Het
Pde3b T A 7: 114,416,149 V200E probably damaging Het
Ppp6r3 A T 19: 3,493,981 L345I probably benign Het
Psd2 G A 18: 35,980,419 A315T probably damaging Het
Rnf111 G A 9: 70,469,373 T328I probably damaging Het
Rnf213 T C 11: 119,458,788 L3825P Het
Rtl1 C T 12: 109,592,475 V977I probably benign Het
Scn1a G A 2: 66,277,656 probably null Het
Slc25a2 G T 18: 37,637,695 N260K probably benign Het
Sprtn T C 8: 124,900,244 V121A probably damaging Het
Ssx2ip T G 3: 146,428,016 L260W probably damaging Het
Syde1 G A 10: 78,588,781 R406C probably damaging Het
Tab1 A G 15: 80,133,171 R6G probably benign Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tenm4 G A 7: 96,735,813 V526I possibly damaging Het
Tfap2b T C 1: 19,234,180 F405L probably damaging Het
Trbv13-1 C A 6: 41,116,391 T87K probably benign Het
Trmt44 G T 5: 35,574,786 A87E probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttn T C 2: 76,787,290 D16279G probably damaging Het
Ttn G A 2: 76,881,328 R8290C unknown Het
Ugt2b37 T A 5: 87,254,731 I14L probably benign Het
Vmn1r13 A T 6: 57,210,626 M257L probably benign Het
Vmn1r184 C T 7: 26,267,177 P116L possibly damaging Het
Zfp426 T C 9: 20,470,591 T367A probably benign Het
Zfp647 A T 15: 76,911,756 C235S probably damaging Het
Other mutations in Ift74
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Ift74 APN 4 94693022 missense probably damaging 1.00
IGL01534:Ift74 APN 4 94679944 missense probably benign 0.00
IGL01701:Ift74 APN 4 94662658 missense possibly damaging 0.94
IGL02155:Ift74 APN 4 94679251 missense probably benign
IGL02455:Ift74 APN 4 94635831 nonsense probably null
IGL02877:Ift74 APN 4 94624781 critical splice donor site probably null
IGL03389:Ift74 APN 4 94621912 missense possibly damaging 0.57
P0005:Ift74 UTSW 4 94662576 splice site probably benign
PIT4243001:Ift74 UTSW 4 94686904 missense possibly damaging 0.94
R0211:Ift74 UTSW 4 94679255 missense probably benign 0.05
R0211:Ift74 UTSW 4 94679255 missense probably benign 0.05
R1019:Ift74 UTSW 4 94635835 missense probably benign 0.20
R1240:Ift74 UTSW 4 94692937 splice site probably null
R1699:Ift74 UTSW 4 94685703 missense probably benign 0.09
R1937:Ift74 UTSW 4 94662646 missense probably benign 0.10
R2114:Ift74 UTSW 4 94627259 missense probably benign 0.00
R2116:Ift74 UTSW 4 94627259 missense probably benign 0.00
R2117:Ift74 UTSW 4 94627259 missense probably benign 0.00
R2181:Ift74 UTSW 4 94632714 missense probably damaging 0.98
R2680:Ift74 UTSW 4 94653028 missense probably damaging 1.00
R3434:Ift74 UTSW 4 94621852 critical splice acceptor site probably null
R3435:Ift74 UTSW 4 94621852 critical splice acceptor site probably null
R4080:Ift74 UTSW 4 94652912 splice site probably null
R4379:Ift74 UTSW 4 94679934 missense probably benign 0.00
R4777:Ift74 UTSW 4 94652997 missense probably benign 0.00
R5197:Ift74 UTSW 4 94662596 missense probably benign 0.00
R5934:Ift74 UTSW 4 94632734 missense probably benign
R5994:Ift74 UTSW 4 94691724 missense possibly damaging 0.86
R6639:Ift74 UTSW 4 94664259 intron probably benign
R6781:Ift74 UTSW 4 94627302 missense probably damaging 1.00
R7156:Ift74 UTSW 4 94660952 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCAGATGTACAAGGCCTGGAAG -3'
(R):5'- GTTCTCAGAGACCCTGGTTTTG -3'

Sequencing Primer
(F):5'- GTACAAGGCCTGGAAGATTATATATG -3'
(R):5'- CAGAGACCCTGGTTTTGATTTTTC -3'
Posted On2019-06-26