Incidental Mutation 'R7239:Sprtn'
ID563082
Institutional Source Beutler Lab
Gene Symbol Sprtn
Ensembl Gene ENSMUSG00000031986
Gene NameSprT-like N-terminal domain
SynonymsGm505, LOC244666
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #R7239 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location124897886-124906161 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 124900244 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 121 (V121A)
Ref Sequence ENSEMBL: ENSMUSP00000034467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034467] [ENSMUST00000098312]
Predicted Effect probably damaging
Transcript: ENSMUST00000034467
AA Change: V121A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034467
Gene: ENSMUSG00000031986
AA Change: V121A

DomainStartEndE-ValueType
SprT 44 213 4.39e-72 SMART
low complexity region 383 405 N/A INTRINSIC
low complexity region 442 462 N/A INTRINSIC
Blast:ZnF_Rad18 463 485 8e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000098312
SMART Domains Protein: ENSMUSP00000095915
Gene: ENSMUSG00000074030

DomainStartEndE-ValueType
Pfam:Vps51 13 99 7.1e-21 PFAM
PH 174 275 2.07e-6 SMART
low complexity region 279 294 N/A INTRINSIC
low complexity region 304 319 N/A INTRINSIC
Pfam:Exo84_C 326 531 6.8e-59 PFAM
low complexity region 633 646 N/A INTRINSIC
Meta Mutation Damage Score 0.212 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may play a role in DNA repair during replication of damaged DNA. This protein recruits valosin containing protein (p97) to stalled DNA replication forks where it may prevent excessive translesional DNA synthesis and limit the number of DNA-damage induced mutations. It may also be involved in replication-related G2/M-checkpoint regulation. Deficiency of a similar protein in mouse causes chromosomal instability and progeroid phenotypes. Mutations in this gene have been associated with Ruijs-Aalfs syndrome (RJALS). Alternatively spliced transcript variants have been identified. [provided by RefSeq, Mar 2015]
PHENOTYPE: Mice homozygous for a knock-out allele die prior to implantation. Mice homozygous for a hypomorphic allele exhibit symptoms of progeria (lordokyphosis, cataracts, cachexia, reduced total fat mass and decreased exercise performance). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510009E07Rik A G 16: 21,653,518 V144A probably damaging Het
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Abca5 A T 11: 110,326,704 Y109N possibly damaging Het
Abcb5 T C 12: 118,928,725 Q433R probably benign Het
Adamts7 G A 9: 90,186,557 probably null Het
Adgrv1 T C 13: 81,476,612 D3746G possibly damaging Het
Arhgap29 C T 3: 121,988,950 S159L probably benign Het
Arhgap5 T A 12: 52,517,376 C377S probably benign Het
Atp1a3 G A 7: 25,000,704 P77L probably damaging Het
B4galt1 T C 4: 40,812,754 D257G probably damaging Het
Bin1 T A 18: 32,406,171 N52K probably damaging Het
Catsperg2 A G 7: 29,710,082 M562T probably benign Het
Ccdc33 G A 9: 58,032,909 Q713* probably null Het
Cd96 A T 16: 46,109,114 L156Q probably damaging Het
Clpb A G 7: 101,711,455 T231A probably damaging Het
Dnmt3a A T 12: 3,872,850 Q151L probably benign Het
Dock2 C T 11: 34,231,677 V1629M probably benign Het
Edem1 G A 6: 108,854,380 D601N probably benign Het
Eno2 C T 6: 124,768,265 V20M probably damaging Het
Eny2 A C 15: 44,433,854 D52A probably benign Het
Esp36 T C 17: 38,417,241 R93G possibly damaging Het
Fam227a A G 15: 79,634,062 probably null Het
Fat4 C A 3: 38,983,840 H3880Q possibly damaging Het
Fbxw24 A T 9: 109,605,530 V334E possibly damaging Het
Flrt1 T C 19: 7,095,964 Q406R probably benign Het
Frmpd2 A G 14: 33,552,077 N1092S probably benign Het
Gm904 C A 13: 50,645,251 T82K probably benign Het
Gnas G C 2: 174,298,615 G252R unknown Het
Gpatch2l A G 12: 86,260,575 probably null Het
Hist1h2ac A T 13: 23,683,610 I103N probably damaging Het
Ift74 T C 4: 94,652,950 V204A probably benign Het
Ikzf4 A G 10: 128,641,244 L119P probably damaging Het
Ing3 G A 6: 21,952,194 E56K probably damaging Het
Klhl25 T C 7: 75,866,768 I474T probably benign Het
Klhl5 T C 5: 65,161,186 V556A probably damaging Het
Krt14 A T 11: 100,204,255 M382K probably benign Het
Lmcd1 T C 6: 112,315,784 V199A possibly damaging Het
Lpcat4 T A 2: 112,242,707 F200I possibly damaging Het
Lrp1b T C 2: 41,004,713 T2282A Het
Lrrk1 T C 7: 66,262,155 T1886A probably benign Het
Meis2 T C 2: 116,059,003 probably null Het
Mki67 C T 7: 135,700,176 R1043K possibly damaging Het
Myct1 G T 10: 5,604,601 R156L possibly damaging Het
Nckap5l G T 15: 99,426,209 H804Q probably damaging Het
Ndst3 T G 3: 123,606,906 E450D probably damaging Het
Nipbl A T 15: 8,292,135 probably null Het
Npy A G 6: 49,823,607 N4D probably benign Het
Olfr855 A T 9: 19,585,191 Y218F probably damaging Het
Osgin2 T C 4: 16,008,748 S18G probably benign Het
Pcdha9 T G 18: 36,998,498 F207V probably benign Het
Pcdhb13 A T 18: 37,444,644 I692F probably damaging Het
Pde3b T A 7: 114,416,149 V200E probably damaging Het
Ppp6r3 A T 19: 3,493,981 L345I probably benign Het
Psd2 G A 18: 35,980,419 A315T probably damaging Het
Rnf111 G A 9: 70,469,373 T328I probably damaging Het
Rnf213 T C 11: 119,458,788 L3825P Het
Rtl1 C T 12: 109,592,475 V977I probably benign Het
Scn1a G A 2: 66,277,656 probably null Het
Slc25a2 G T 18: 37,637,695 N260K probably benign Het
Ssx2ip T G 3: 146,428,016 L260W probably damaging Het
Syde1 G A 10: 78,588,781 R406C probably damaging Het
Tab1 A G 15: 80,133,171 R6G probably benign Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tenm4 G A 7: 96,735,813 V526I possibly damaging Het
Tfap2b T C 1: 19,234,180 F405L probably damaging Het
Trbv13-1 C A 6: 41,116,391 T87K probably benign Het
Trmt44 G T 5: 35,574,786 A87E probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttn T C 2: 76,787,290 D16279G probably damaging Het
Ttn G A 2: 76,881,328 R8290C unknown Het
Ugt2b37 T A 5: 87,254,731 I14L probably benign Het
Vmn1r13 A T 6: 57,210,626 M257L probably benign Het
Vmn1r184 C T 7: 26,267,177 P116L possibly damaging Het
Zfp426 T C 9: 20,470,591 T367A probably benign Het
Zfp647 A T 15: 76,911,756 C235S probably damaging Het
Other mutations in Sprtn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Sprtn APN 8 124900298 missense probably damaging 1.00
IGL02735:Sprtn APN 8 124903387 missense probably benign 0.03
IGL02740:Sprtn APN 8 124898303 missense probably damaging 1.00
IGL03234:Sprtn APN 8 124903149 missense possibly damaging 0.79
R0600:Sprtn UTSW 8 124900218 missense probably damaging 1.00
R1718:Sprtn UTSW 8 124898357 missense probably damaging 1.00
R1719:Sprtn UTSW 8 124901633 missense probably damaging 1.00
R1808:Sprtn UTSW 8 124903031 missense probably benign 0.03
R6390:Sprtn UTSW 8 124903219 missense probably benign 0.01
R6474:Sprtn UTSW 8 124899134 nonsense probably null
R7163:Sprtn UTSW 8 124898305 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGGGTCTGCAGAAGGATAG -3'
(R):5'- ACCTAGTTCACTTTTACTGAATGGC -3'

Sequencing Primer
(F):5'- GTGGTGGCAGAAACCTTTAATCCC -3'
(R):5'- CACCACTTGGGCTGAGTTAG -3'
Posted On2019-06-26