Incidental Mutation 'R0578:Capns1'
ID56311
Institutional Source Beutler Lab
Gene Symbol Capns1
Ensembl Gene ENSMUSG00000001794
Gene Namecalpain, small subunit 1
SynonymsD7Ertd146e, Capa-4, Capn4, Capa4
MMRRC Submission 038768-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0578 (G1)
Quality Score101
Status Not validated
Chromosome7
Chromosomal Location30186936-30198811 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 30194028 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001845] [ENSMUST00000108196] [ENSMUST00000126116]
Predicted Effect unknown
Transcript: ENSMUST00000001845
AA Change: L20Q
SMART Domains Protein: ENSMUSP00000001845
Gene: ENSMUSG00000001794
AA Change: L20Q

DomainStartEndE-ValueType
low complexity region 10 64 N/A INTRINSIC
EFh 143 171 3.93e0 SMART
EFh 173 201 1.42e1 SMART
EFh 238 265 6.09e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108196
SMART Domains Protein: ENSMUSP00000103831
Gene: ENSMUSG00000001794

DomainStartEndE-ValueType
EFh 75 103 3.93e0 SMART
EFh 105 133 1.42e1 SMART
EFh 170 197 6.09e1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000126116
AA Change: L20Q
SMART Domains Protein: ENSMUSP00000117951
Gene: ENSMUSG00000001794
AA Change: L20Q

DomainStartEndE-ValueType
low complexity region 10 64 N/A INTRINSIC
EFh 143 171 3.93e0 SMART
EFh 173 201 1.42e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129761
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141851
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146852
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148973
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181153
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207082
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208688
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the calpain small subunit family. Calpains are calcium-dependent cysteine proteinases that are widely distributed in mammalian cells. Calpains operate as heterodimers, comprising a specific large catalytic subunit (calpain 1 subunit in Calpain I, and calpain 2 subunit in Calpain II), and a common small regulatory subunit encoded by this gene. This encoded protein is essential for the stability and function of both calpain heterodimers, whose proteolytic activities influence various cellular functions including apoptosis, proliferation, migration, adhesion, and autophagy. Calpains have been implicated in neurodegenerative processes, such as myotonic dystrophy. A pseudogene of this gene has been defined on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality around E11.5. Mutant embryos exhibit cardiac developmental defects, reduced yolk sac vasculature, hemorrhaging in the area between the embryo and amnion, and accumulation of nucleated erythroid cells in the heart chambers, blood vessels, and developing liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,059,355 Y56C possibly damaging Het
Abca5 A T 11: 110,276,489 C1500* probably null Het
Acr C G 15: 89,569,475 H72Q probably damaging Het
Adam18 T C 8: 24,641,847 D416G possibly damaging Het
Afap1l2 T A 19: 56,915,782 Y691F probably benign Het
Akna A G 4: 63,370,910 S1259P probably benign Het
Atad2 G A 15: 58,105,568 T525I probably damaging Het
Atp2a1 T G 7: 126,450,143 M576L probably benign Het
B4galt6 T C 18: 20,727,956 probably benign Het
Best3 A G 10: 117,008,999 D353G probably benign Het
Btg3 A T 16: 78,364,946 D125E probably benign Het
C87499 T A 4: 88,634,139 I2F probably benign Het
Cabin1 A T 10: 75,713,610 D1320E probably damaging Het
Cachd1 A C 4: 100,994,842 probably benign Het
Cad T C 5: 31,058,776 V151A probably benign Het
Catsperg2 T A 7: 29,704,691 T860S possibly damaging Het
Ccdc61 T C 7: 18,903,475 T76A probably benign Het
Cdipt T A 7: 126,979,530 probably null Het
Cyp2d12 G A 15: 82,556,383 probably benign Het
Dennd4c C A 4: 86,812,422 P852Q probably damaging Het
Dsg2 G A 18: 20,594,234 V613I probably benign Het
Dusp16 G C 6: 134,718,321 L516V probably damaging Het
Eif2ak4 T G 2: 118,474,991 probably benign Het
Faf2 C T 13: 54,621,845 A2V possibly damaging Het
Gas2l3 A G 10: 89,417,075 I236T probably damaging Het
Gm6605 C A 7: 38,448,275 noncoding transcript Het
Got1 G T 19: 43,515,783 S66R probably benign Het
Gpr149 T A 3: 62,602,689 H335L possibly damaging Het
Hadhb A G 5: 30,178,806 I342M probably benign Het
Helz T A 11: 107,686,400 V1859D unknown Het
Htr1a T A 13: 105,445,087 N278K probably damaging Het
Inppl1 T C 7: 101,831,588 E355G probably damaging Het
Isl2 A G 9: 55,545,035 Y297C probably damaging Het
Kat7 T C 11: 95,291,524 H250R probably benign Het
Klhl30 A T 1: 91,354,352 D225V probably benign Het
Mtch2 T C 2: 90,852,830 probably benign Het
Muc4 C A 16: 32,755,690 probably benign Het
Ncoa7 A C 10: 30,701,917 probably null Het
Nuf2 T A 1: 169,510,549 probably benign Het
Olfr767 A G 10: 129,079,193 Y257H probably damaging Het
Olfr994 T C 2: 85,430,673 D52G probably benign Het
Pced1a T A 2: 130,419,843 S297C probably damaging Het
Pi15 A T 1: 17,602,849 K91* probably null Het
Pla2g4e C T 2: 120,244,681 probably benign Het
Plce1 A T 19: 38,777,939 H2136L probably damaging Het
Plec A G 15: 76,176,884 L2973P probably damaging Het
Poln A G 5: 34,014,338 I695T probably damaging Het
R3hdm1 C T 1: 128,231,437 Q950* probably null Het
Rxra C T 2: 27,759,570 A429V probably damaging Het
Scnn1a G A 6: 125,322,244 G96S probably damaging Het
Senp5 T A 16: 31,989,345 T337S possibly damaging Het
Smg9 A G 7: 24,415,043 D269G probably damaging Het
Srsf11 C T 3: 158,012,067 probably benign Het
Tmtc1 C T 6: 148,355,218 probably benign Het
Vmn2r19 T C 6: 123,335,972 V667A probably damaging Het
Other mutations in Capns1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Capns1 APN 7 30190140 missense probably benign 0.00
IGL01128:Capns1 APN 7 30190133 missense probably benign 0.00
IGL02175:Capns1 APN 7 30190532 missense probably benign 0.28
IGL02966:Capns1 APN 7 30192193 missense probably damaging 1.00
IGL02799:Capns1 UTSW 7 30192219 missense probably benign 0.05
R1484:Capns1 UTSW 7 30194086 unclassified probably benign
R2153:Capns1 UTSW 7 30192340 missense probably damaging 1.00
R5111:Capns1 UTSW 7 30192519 missense probably benign
R5323:Capns1 UTSW 7 30187722 missense possibly damaging 0.85
R5350:Capns1 UTSW 7 30190126 missense probably damaging 1.00
R6684:Capns1 UTSW 7 30193899 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGTGACACCAGCCTCGCTAGAATC -3'
(R):5'- CTCCCCAATCTAGTTGCCGGAAATG -3'

Sequencing Primer
(F):5'- GAATTCTCAGGTCGGACTCTAAG -3'
(R):5'- CTAGTTGCCGGAAATGCTTGC -3'
Posted On2013-07-11