Incidental Mutation 'R7239:Bin1'
ID563112
Institutional Source Beutler Lab
Gene Symbol Bin1
Ensembl Gene ENSMUSG00000024381
Gene Namebridging integrator 1
SynonymsAmphl, Amphiphysin 2
MMRRC Submission
Accession Numbers

Genbank: NM_009668, NM_001083334; MGI: 108092

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7239 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location32377217-32435736 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32406171 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 52 (N52K)
Ref Sequence ENSEMBL: ENSMUSP00000089590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025239] [ENSMUST00000091967]
Predicted Effect probably damaging
Transcript: ENSMUST00000025239
AA Change: N52K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025239
Gene: ENSMUSG00000024381
AA Change: N52K

DomainStartEndE-ValueType
BAR 17 269 3.04e-81 SMART
low complexity region 296 305 N/A INTRINSIC
PDB:1MV3|A 306 378 3e-31 PDB
Blast:BAR 395 506 4e-48 BLAST
SH3 518 588 5.4e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000091967
AA Change: N52K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089590
Gene: ENSMUSG00000024381
AA Change: N52K

DomainStartEndE-ValueType
BAR 17 238 3.92e-84 SMART
low complexity region 265 274 N/A INTRINSIC
low complexity region 309 315 N/A INTRINSIC
Blast:BAR 319 395 2e-8 BLAST
SH3 407 477 5.4e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes several isoforms of a nucleocytoplasmic adaptor protein, one of which was initially identified as a MYC-interacting protein with features of a tumor suppressor. Isoforms that are expressed in the central nervous system may be involved in synaptic vesicle endocytosis and may interact with dynamin, synaptojanin, endophilin, and clathrin. Isoforms that are expressed in muscle and ubiquitously expressed isoforms localize to the cytoplasm and nucleus and activate a caspase-independent apoptotic process. Studies in mouse suggest that this gene plays an important role in cardiac muscle development. Alternate splicing of the gene results in several transcript variants encoding different isoforms. Aberrant splice variants expressed in tumor cell lines have also been described. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous mutation of this gene results in thickened ventricular walls, densely packed myocardiocytes, and disorganization of myofibrils. Mutant animals die shortly after birth. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510009E07Rik A G 16: 21,653,518 V144A probably damaging Het
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Abca5 A T 11: 110,326,704 Y109N possibly damaging Het
Abcb5 T C 12: 118,928,725 Q433R probably benign Het
Adamts7 G A 9: 90,186,557 probably null Het
Adgrv1 T C 13: 81,476,612 D3746G possibly damaging Het
Arhgap29 C T 3: 121,988,950 S159L probably benign Het
Arhgap5 T A 12: 52,517,376 C377S probably benign Het
Atp1a3 G A 7: 25,000,704 P77L probably damaging Het
B4galt1 T C 4: 40,812,754 D257G probably damaging Het
Catsperg2 A G 7: 29,710,082 M562T probably benign Het
Ccdc33 G A 9: 58,032,909 Q713* probably null Het
Cd96 A T 16: 46,109,114 L156Q probably damaging Het
Clpb A G 7: 101,711,455 T231A probably damaging Het
Dnmt3a A T 12: 3,872,850 Q151L probably benign Het
Dock2 C T 11: 34,231,677 V1629M probably benign Het
Edem1 G A 6: 108,854,380 D601N probably benign Het
Eno2 C T 6: 124,768,265 V20M probably damaging Het
Eny2 A C 15: 44,433,854 D52A probably benign Het
Esp36 T C 17: 38,417,241 R93G possibly damaging Het
Fam227a A G 15: 79,634,062 probably null Het
Fat4 C A 3: 38,983,840 H3880Q possibly damaging Het
Fbxw24 A T 9: 109,605,530 V334E possibly damaging Het
Flrt1 T C 19: 7,095,964 Q406R probably benign Het
Frmpd2 A G 14: 33,552,077 N1092S probably benign Het
Gm904 C A 13: 50,645,251 T82K probably benign Het
Gnas G C 2: 174,298,615 G252R unknown Het
Gpatch2l A G 12: 86,260,575 probably null Het
Hist1h2ac A T 13: 23,683,610 I103N probably damaging Het
Ift74 T C 4: 94,652,950 V204A probably benign Het
Ikzf4 A G 10: 128,641,244 L119P probably damaging Het
Ing3 G A 6: 21,952,194 E56K probably damaging Het
Klhl25 T C 7: 75,866,768 I474T probably benign Het
Klhl5 T C 5: 65,161,186 V556A probably damaging Het
Krt14 A T 11: 100,204,255 M382K probably benign Het
Lmcd1 T C 6: 112,315,784 V199A possibly damaging Het
Lpcat4 T A 2: 112,242,707 F200I possibly damaging Het
Lrp1b T C 2: 41,004,713 T2282A Het
Lrrk1 T C 7: 66,262,155 T1886A probably benign Het
Meis2 T C 2: 116,059,003 probably null Het
Mki67 C T 7: 135,700,176 R1043K possibly damaging Het
Myct1 G T 10: 5,604,601 R156L possibly damaging Het
Nckap5l G T 15: 99,426,209 H804Q probably damaging Het
Ndst3 T G 3: 123,606,906 E450D probably damaging Het
Nipbl A T 15: 8,292,135 probably null Het
Npy A G 6: 49,823,607 N4D probably benign Het
Olfr855 A T 9: 19,585,191 Y218F probably damaging Het
Osgin2 T C 4: 16,008,748 S18G probably benign Het
Pcdha9 T G 18: 36,998,498 F207V probably benign Het
Pcdhb13 A T 18: 37,444,644 I692F probably damaging Het
Pde3b T A 7: 114,416,149 V200E probably damaging Het
Ppp6r3 A T 19: 3,493,981 L345I probably benign Het
Psd2 G A 18: 35,980,419 A315T probably damaging Het
Rnf111 G A 9: 70,469,373 T328I probably damaging Het
Rnf213 T C 11: 119,458,788 L3825P Het
Rtl1 C T 12: 109,592,475 V977I probably benign Het
Scn1a G A 2: 66,277,656 probably null Het
Slc25a2 G T 18: 37,637,695 N260K probably benign Het
Sprtn T C 8: 124,900,244 V121A probably damaging Het
Ssx2ip T G 3: 146,428,016 L260W probably damaging Het
Syde1 G A 10: 78,588,781 R406C probably damaging Het
Tab1 A G 15: 80,133,171 R6G probably benign Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tenm4 G A 7: 96,735,813 V526I possibly damaging Het
Tfap2b T C 1: 19,234,180 F405L probably damaging Het
Trbv13-1 C A 6: 41,116,391 T87K probably benign Het
Trmt44 G T 5: 35,574,786 A87E probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttn T C 2: 76,787,290 D16279G probably damaging Het
Ttn G A 2: 76,881,328 R8290C unknown Het
Ugt2b37 T A 5: 87,254,731 I14L probably benign Het
Vmn1r13 A T 6: 57,210,626 M257L probably benign Het
Vmn1r184 C T 7: 26,267,177 P116L possibly damaging Het
Zfp426 T C 9: 20,470,591 T367A probably benign Het
Zfp647 A T 15: 76,911,756 C235S probably damaging Het
Other mutations in Bin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Bin1 APN 18 32420107 missense probably damaging 1.00
IGL00972:Bin1 APN 18 32424834 missense probably benign 0.01
IGL01551:Bin1 APN 18 32377458 missense probably benign 0.44
IGL01609:Bin1 APN 18 32419925 missense probably damaging 1.00
R1370:Bin1 UTSW 18 32429703 missense probably benign 0.05
R1496:Bin1 UTSW 18 32412704 missense probably damaging 0.99
R1688:Bin1 UTSW 18 32419935 splice site probably benign
R1688:Bin1 UTSW 18 32424972 splice site probably benign
R2483:Bin1 UTSW 18 32414227 missense probably damaging 1.00
R3941:Bin1 UTSW 18 32406158 missense probably damaging 1.00
R5026:Bin1 UTSW 18 32419930 critical splice donor site probably null
R5768:Bin1 UTSW 18 32426211 splice site probably null
R6770:Bin1 UTSW 18 32406149 missense probably damaging 1.00
R6906:Bin1 UTSW 18 32421925 missense probably benign 0.00
X0011:Bin1 UTSW 18 32426279 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTCCTCATGATCTTCGGGC -3'
(R):5'- GGTAAGGATGCCCTAAGAGTGTTTC -3'

Sequencing Primer
(F):5'- TCATGATCTTCGGGCCCCAG -3'
(R):5'- CAGGCTTTAGAGTCAGACACCTTG -3'
Posted On2019-06-26