Incidental Mutation 'R7239:Ppp6r3'
ID563117
Institutional Source Beutler Lab
Gene Symbol Ppp6r3
Ensembl Gene ENSMUSG00000024908
Gene Nameprotein phosphatase 6, regulatory subunit 3
SynonymsPp6r3, D19Ertd703e, D19Bwg1430e, 4930528G08Rik, Saps3, 9130026N02Rik, Pptcs3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.885) question?
Stock #R7239 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location3454928-3575749 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 3493981 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 345 (L345I)
Ref Sequence ENSEMBL: ENSMUSP00000025846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025846] [ENSMUST00000113997] [ENSMUST00000172362]
Predicted Effect probably benign
Transcript: ENSMUST00000025846
AA Change: L345I

PolyPhen 2 Score 0.379 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000025846
Gene: ENSMUSG00000024908
AA Change: L345I

DomainStartEndE-ValueType
coiled coil region 25 52 N/A INTRINSIC
Pfam:SAPS 128 365 2.7e-69 PFAM
Pfam:SAPS 360 513 1.4e-44 PFAM
low complexity region 609 627 N/A INTRINSIC
low complexity region 743 758 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113997
AA Change: L345I

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000109630
Gene: ENSMUSG00000024908
AA Change: L345I

DomainStartEndE-ValueType
coiled coil region 25 52 N/A INTRINSIC
Pfam:SAPS 128 365 5.8e-69 PFAM
Pfam:SAPS 363 513 2.7e-44 PFAM
low complexity region 638 656 N/A INTRINSIC
low complexity region 772 787 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000172362
AA Change: L345I

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131084
Gene: ENSMUSG00000024908
AA Change: L345I

DomainStartEndE-ValueType
coiled coil region 25 52 N/A INTRINSIC
Pfam:SAPS 128 365 2.6e-69 PFAM
Pfam:SAPS 360 513 1.3e-44 PFAM
low complexity region 592 610 N/A INTRINSIC
low complexity region 726 741 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein phosphatase regulatory subunits, such as SAPS3, modulate the activity of protein phosphatase catalytic subunits by restricting substrate specificity, recruiting substrates, and determining the intracellular localization of the holoenzyme. SAPS3 is a regulatory subunit for the protein phosphatase-6 catalytic subunit (PPP6C; MIM 612725) (Stefansson and Brautigan, 2006 [PubMed 16769727]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510009E07Rik A G 16: 21,653,518 V144A probably damaging Het
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Abca5 A T 11: 110,326,704 Y109N possibly damaging Het
Abcb5 T C 12: 118,928,725 Q433R probably benign Het
Adamts7 G A 9: 90,186,557 probably null Het
Adgrv1 T C 13: 81,476,612 D3746G possibly damaging Het
Arhgap29 C T 3: 121,988,950 S159L probably benign Het
Arhgap5 T A 12: 52,517,376 C377S probably benign Het
Atp1a3 G A 7: 25,000,704 P77L probably damaging Het
B4galt1 T C 4: 40,812,754 D257G probably damaging Het
Bin1 T A 18: 32,406,171 N52K probably damaging Het
Catsperg2 A G 7: 29,710,082 M562T probably benign Het
Ccdc33 G A 9: 58,032,909 Q713* probably null Het
Cd96 A T 16: 46,109,114 L156Q probably damaging Het
Clpb A G 7: 101,711,455 T231A probably damaging Het
Dnmt3a A T 12: 3,872,850 Q151L probably benign Het
Dock2 C T 11: 34,231,677 V1629M probably benign Het
Edem1 G A 6: 108,854,380 D601N probably benign Het
Eno2 C T 6: 124,768,265 V20M probably damaging Het
Eny2 A C 15: 44,433,854 D52A probably benign Het
Esp36 T C 17: 38,417,241 R93G possibly damaging Het
Fam227a A G 15: 79,634,062 probably null Het
Fat4 C A 3: 38,983,840 H3880Q possibly damaging Het
Fbxw24 A T 9: 109,605,530 V334E possibly damaging Het
Flrt1 T C 19: 7,095,964 Q406R probably benign Het
Frmpd2 A G 14: 33,552,077 N1092S probably benign Het
Gm904 C A 13: 50,645,251 T82K probably benign Het
Gnas G C 2: 174,298,615 G252R unknown Het
Gpatch2l A G 12: 86,260,575 probably null Het
Hist1h2ac A T 13: 23,683,610 I103N probably damaging Het
Ift74 T C 4: 94,652,950 V204A probably benign Het
Ikzf4 A G 10: 128,641,244 L119P probably damaging Het
Ing3 G A 6: 21,952,194 E56K probably damaging Het
Klhl25 T C 7: 75,866,768 I474T probably benign Het
Klhl5 T C 5: 65,161,186 V556A probably damaging Het
Krt14 A T 11: 100,204,255 M382K probably benign Het
Lmcd1 T C 6: 112,315,784 V199A possibly damaging Het
Lpcat4 T A 2: 112,242,707 F200I possibly damaging Het
Lrp1b T C 2: 41,004,713 T2282A Het
Lrrk1 T C 7: 66,262,155 T1886A probably benign Het
Meis2 T C 2: 116,059,003 probably null Het
Mki67 C T 7: 135,700,176 R1043K possibly damaging Het
Myct1 G T 10: 5,604,601 R156L possibly damaging Het
Nckap5l G T 15: 99,426,209 H804Q probably damaging Het
Ndst3 T G 3: 123,606,906 E450D probably damaging Het
Nipbl A T 15: 8,292,135 probably null Het
Npy A G 6: 49,823,607 N4D probably benign Het
Olfr855 A T 9: 19,585,191 Y218F probably damaging Het
Osgin2 T C 4: 16,008,748 S18G probably benign Het
Pcdha9 T G 18: 36,998,498 F207V probably benign Het
Pcdhb13 A T 18: 37,444,644 I692F probably damaging Het
Pde3b T A 7: 114,416,149 V200E probably damaging Het
Psd2 G A 18: 35,980,419 A315T probably damaging Het
Rnf111 G A 9: 70,469,373 T328I probably damaging Het
Rnf213 T C 11: 119,458,788 L3825P Het
Rtl1 C T 12: 109,592,475 V977I probably benign Het
Scn1a G A 2: 66,277,656 probably null Het
Slc25a2 G T 18: 37,637,695 N260K probably benign Het
Sprtn T C 8: 124,900,244 V121A probably damaging Het
Ssx2ip T G 3: 146,428,016 L260W probably damaging Het
Syde1 G A 10: 78,588,781 R406C probably damaging Het
Tab1 A G 15: 80,133,171 R6G probably benign Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tenm4 G A 7: 96,735,813 V526I possibly damaging Het
Tfap2b T C 1: 19,234,180 F405L probably damaging Het
Trbv13-1 C A 6: 41,116,391 T87K probably benign Het
Trmt44 G T 5: 35,574,786 A87E probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttn T C 2: 76,787,290 D16279G probably damaging Het
Ttn G A 2: 76,881,328 R8290C unknown Het
Ugt2b37 T A 5: 87,254,731 I14L probably benign Het
Vmn1r13 A T 6: 57,210,626 M257L probably benign Het
Vmn1r184 C T 7: 26,267,177 P116L possibly damaging Het
Zfp426 T C 9: 20,470,591 T367A probably benign Het
Zfp647 A T 15: 76,911,756 C235S probably damaging Het
Other mutations in Ppp6r3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Ppp6r3 APN 19 3514729 splice site probably null
IGL00340:Ppp6r3 APN 19 3518324 missense probably damaging 1.00
IGL00585:Ppp6r3 APN 19 3490826 missense probably damaging 0.99
IGL01304:Ppp6r3 APN 19 3467261 missense probably damaging 0.99
IGL02048:Ppp6r3 APN 19 3473848 missense possibly damaging 0.96
IGL02055:Ppp6r3 APN 19 3521781 missense probably benign 0.01
IGL02108:Ppp6r3 APN 19 3492494 missense probably damaging 1.00
IGL02227:Ppp6r3 APN 19 3518245 missense possibly damaging 0.56
IGL02427:Ppp6r3 APN 19 3466580 missense probably null
IGL02441:Ppp6r3 APN 19 3464693 missense probably benign 0.14
IGL02805:Ppp6r3 APN 19 3492428 missense probably benign 0.15
IGL03298:Ppp6r3 APN 19 3521829 missense probably damaging 0.97
PIT1430001:Ppp6r3 UTSW 19 3471059 nonsense probably null
R0324:Ppp6r3 UTSW 19 3464693 missense probably benign 0.00
R0362:Ppp6r3 UTSW 19 3478285 missense probably damaging 0.96
R1876:Ppp6r3 UTSW 19 3471971 splice site probably benign
R2860:Ppp6r3 UTSW 19 3521782 missense possibly damaging 0.49
R2861:Ppp6r3 UTSW 19 3521782 missense possibly damaging 0.49
R2862:Ppp6r3 UTSW 19 3521782 missense possibly damaging 0.49
R3958:Ppp6r3 UTSW 19 3496583 missense probably damaging 0.99
R4158:Ppp6r3 UTSW 19 3512037 missense probably damaging 0.97
R4160:Ppp6r3 UTSW 19 3512037 missense probably damaging 0.97
R4473:Ppp6r3 UTSW 19 3511978 missense probably damaging 1.00
R4901:Ppp6r3 UTSW 19 3467229 missense probably damaging 1.00
R4996:Ppp6r3 UTSW 19 3473833 missense probably damaging 0.98
R5139:Ppp6r3 UTSW 19 3464610 missense probably damaging 1.00
R5414:Ppp6r3 UTSW 19 3507330 missense probably damaging 1.00
R5776:Ppp6r3 UTSW 19 3526901 missense possibly damaging 0.77
R6290:Ppp6r3 UTSW 19 3494011 missense probably benign
R6525:Ppp6r3 UTSW 19 3493936 missense probably damaging 0.99
R6797:Ppp6r3 UTSW 19 3514719 missense probably damaging 1.00
R6977:Ppp6r3 UTSW 19 3467272 missense probably damaging 1.00
R7176:Ppp6r3 UTSW 19 3471989 missense probably damaging 0.99
R7178:Ppp6r3 UTSW 19 3518337 missense probably benign 0.00
R7326:Ppp6r3 UTSW 19 3507325 missense probably damaging 1.00
R7536:Ppp6r3 UTSW 19 3507341 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- CTGCTCAGGGTGACAGTTAAAG -3'
(R):5'- GGCTACAAGGTTAGATTTCTCTCAG -3'

Sequencing Primer
(F):5'- GTGACAGTTAAAGAGATCTGTCCCC -3'
(R):5'- CAGGGCTTAAATTGTATGGTATTAGC -3'
Posted On2019-06-26