Incidental Mutation 'R7240:Notch4'
ID563166
Institutional Source Beutler Lab
Gene Symbol Notch4
Ensembl Gene ENSMUSG00000015468
Gene Namenotch 4
SynonymsInt3, N4, Int-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7240 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location34564268-34588503 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34576471 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 792 (T792A)
Ref Sequence ENSEMBL: ENSMUSP00000015612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015612] [ENSMUST00000173389]
Predicted Effect probably benign
Transcript: ENSMUST00000015612
AA Change: T792A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000015612
Gene: ENSMUSG00000015468
AA Change: T792A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF 24 60 3.2e-4 SMART
EGF 64 112 1.07e-5 SMART
EGF 118 152 5.49e-3 SMART
EGF 156 189 9.33e-6 SMART
EGF_CA 191 229 1.42e-10 SMART
EGF 234 271 1.11e-3 SMART
EGF 276 309 1.84e-4 SMART
EGF_CA 311 350 2.52e-11 SMART
EGF_CA 352 388 1.85e-9 SMART
EGF 392 427 1.58e-3 SMART
EGF_CA 429 470 2.46e-14 SMART
EGF_CA 472 508 5.03e-11 SMART
EGF_CA 510 546 6.74e-12 SMART
EGF_CA 548 584 2.98e-13 SMART
EGF_CA 586 622 7.63e-11 SMART
EGF_like 645 686 2.86e1 SMART
EGF 691 724 3.48e-5 SMART
EGF 729 762 3.62e-3 SMART
EGF_CA 764 800 1.48e-8 SMART
EGF 806 839 1.74e-5 SMART
EGF 844 877 2.3e-5 SMART
EGF 881 924 3.59e-7 SMART
EGF_CA 926 962 7.29e-8 SMART
EGF_CA 965 1000 4.42e-7 SMART
EGF_CA 1002 1040 4.56e-9 SMART
EGF 1045 1081 6.16e-6 SMART
EGF 1086 1122 8.65e-1 SMART
EGF 1129 1167 1.45e-2 SMART
NL 1159 1200 6.79e-13 SMART
NL 1203 1242 2.01e-15 SMART
NL 1243 1281 1.85e-14 SMART
NOD 1287 1341 4.37e-8 SMART
NODP 1373 1437 2.12e-6 SMART
transmembrane domain 1441 1463 N/A INTRINSIC
low complexity region 1525 1539 N/A INTRINSIC
ANK 1578 1623 2.5e3 SMART
ANK 1628 1657 1.12e-3 SMART
ANK 1661 1691 5.01e-1 SMART
ANK 1695 1724 1.65e-1 SMART
ANK 1728 1757 4.56e-4 SMART
ANK 1761 1790 2.88e-1 SMART
low complexity region 1889 1906 N/A INTRINSIC
low complexity region 1925 1937 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173389
AA Change: T796A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000133574
Gene: ENSMUSG00000015468
AA Change: T796A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF 28 64 3.2e-4 SMART
EGF 68 116 1.07e-5 SMART
EGF 122 156 5.49e-3 SMART
EGF 160 193 9.33e-6 SMART
EGF_CA 195 233 1.42e-10 SMART
EGF 238 275 1.11e-3 SMART
EGF 280 313 1.84e-4 SMART
EGF_CA 315 354 2.52e-11 SMART
EGF_CA 356 392 1.85e-9 SMART
EGF 396 431 1.58e-3 SMART
EGF_CA 433 474 2.46e-14 SMART
EGF_CA 476 512 5.03e-11 SMART
EGF_CA 514 550 6.74e-12 SMART
EGF_CA 552 588 2.98e-13 SMART
EGF_CA 590 626 7.63e-11 SMART
EGF_like 649 690 2.86e1 SMART
EGF 695 728 3.48e-5 SMART
EGF 733 766 3.62e-3 SMART
EGF_CA 768 804 1.48e-8 SMART
EGF 810 843 1.74e-5 SMART
EGF 848 881 2.3e-5 SMART
EGF 885 928 3.59e-7 SMART
EGF_like 930 955 7.02e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NOTCH family of proteins. Members of this Type I transmembrane protein family share structural characteristics including an extracellular domain consisting of multiple epidermal growth factor-like (EGF) repeats, and an intracellular domain consisting of multiple different domain types. Notch signaling is an evolutionarily conserved intercellular signaling pathway that regulates interactions between physically adjacent cells through binding of Notch family receptors to their cognate ligands. The encoded preproprotein is proteolytically processed in the trans-Golgi network to generate two polypeptide chains that heterodimerize to form the mature cell-surface receptor. This receptor may play a role in vascular, renal and hepatic development. Mutations in this gene may be associated with schizophrenia. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile but exhibit a slight delay in postnatal retinal angiogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210017I01Rik A G 3: 92,605,075 I59T unknown Het
Aspm C T 1: 139,478,651 Q1759* probably null Het
Atn1 A T 6: 124,747,898 I124K unknown Het
Catsper2 TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT 2: 121,397,572 probably benign Het
Ccdc88c C T 12: 100,944,939 V879M probably benign Het
Cd300c A G 11: 114,959,783 C65R possibly damaging Het
Cd69 A T 6: 129,270,042 S112T possibly damaging Het
Cdh19 T C 1: 110,893,407 T534A probably benign Het
Cdk5rap2 T A 4: 70,291,908 D701V probably damaging Het
D130052B06Rik A G 11: 33,623,874 H157R possibly damaging Het
Dpf1 T A 7: 29,311,627 F150L probably benign Het
Dsg1c T C 18: 20,283,109 L689P probably damaging Het
Dstyk G A 1: 132,454,123 M538I probably benign Het
E4f1 T A 17: 24,444,325 I669F probably damaging Het
Gm7138 T C 10: 77,776,755 T64A unknown Het
Gnai2 A C 9: 107,615,773 D310E Het
Iqca A G 1: 90,070,550 V567A possibly damaging Het
Iqgap1 A T 7: 80,759,839 N249K probably benign Het
Lamc1 A G 1: 153,234,650 V1093A possibly damaging Het
Mfap3 A G 11: 57,529,756 K188E probably damaging Het
N4bp2 T A 5: 65,794,545 V431D probably damaging Het
Ntn4 A G 10: 93,745,741 H592R probably damaging Het
Ofcc1 A G 13: 40,208,841 C202R probably benign Het
Olfr13 A G 6: 43,174,501 K172E probably benign Het
Olfr418 T C 1: 173,270,994 I273T probably benign Het
Olfr476 T C 7: 107,968,188 S264P probably benign Het
Olfr497 A G 7: 108,422,933 M121V probably damaging Het
Olfr922 A G 9: 38,815,713 D70G probably benign Het
Olfr938 A T 9: 39,078,610 M45K probably damaging Het
Parpbp G A 10: 88,124,940 T228I probably damaging Het
Pcdhgb8 G A 18: 37,763,703 V609M probably damaging Het
Pla2g4d T C 2: 120,270,349 N543S probably damaging Het
Puf60 A G 15: 76,072,539 probably benign Het
Rbm6 A T 9: 107,852,896 D184E probably damaging Het
Rnase9 A C 14: 51,038,979 S181A probably benign Het
Rnpc3 T A 3: 113,616,831 R270S probably damaging Het
Rundc1 T C 11: 101,431,548 probably null Het
Ryr1 T C 7: 29,052,015 S3715G possibly damaging Het
Scn3a A T 2: 65,469,042 D1373E possibly damaging Het
Serpina3k T G 12: 104,340,602 I31S probably benign Het
Sipa1l2 A G 8: 125,469,860 F712L probably damaging Het
Slc22a29 A G 19: 8,161,511 V529A probably damaging Het
Tdrd3 A G 14: 87,458,803 N58S probably benign Het
Tmc2 C T 2: 130,234,804 T350I possibly damaging Het
Tpst2 T C 5: 112,307,678 C28R probably benign Het
Trbv21 A T 6: 41,202,958 K69N probably benign Het
Trpm2 A G 10: 77,935,876 probably null Het
Ttn A G 2: 76,848,990 V10796A unknown Het
Ush2a A G 1: 188,911,661 T4407A possibly damaging Het
Vmn2r95 A G 17: 18,451,963 H726R probably benign Het
Zfp777 A G 6: 48,044,449 S80P probably benign Het
Other mutations in Notch4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Notch4 APN 17 34575561 critical splice donor site probably null
IGL01022:Notch4 APN 17 34565697 missense probably damaging 1.00
IGL01356:Notch4 APN 17 34581026 missense possibly damaging 0.67
IGL01634:Notch4 APN 17 34572588 missense probably damaging 1.00
IGL02150:Notch4 APN 17 34584613 missense probably damaging 1.00
IGL02248:Notch4 APN 17 34587198 missense probably damaging 1.00
IGL02271:Notch4 APN 17 34568471 missense probably damaging 1.00
IGL02299:Notch4 APN 17 34578004 missense probably damaging 1.00
IGL02561:Notch4 APN 17 34568160 splice site probably benign
IGL02604:Notch4 APN 17 34565388 splice site probably null
IGL03323:Notch4 APN 17 34582471 missense probably damaging 1.00
IGL03366:Notch4 APN 17 34572568 missense probably damaging 1.00
IGL03408:Notch4 APN 17 34565568 missense probably benign 0.03
K3955:Notch4 UTSW 17 34568462 missense probably damaging 1.00
R0123:Notch4 UTSW 17 34565363 missense possibly damaging 0.85
R0366:Notch4 UTSW 17 34581499 splice site probably benign
R0446:Notch4 UTSW 17 34565363 missense possibly damaging 0.85
R0490:Notch4 UTSW 17 34582890 missense probably damaging 1.00
R0504:Notch4 UTSW 17 34575091 missense probably damaging 1.00
R0545:Notch4 UTSW 17 34583433 missense probably damaging 1.00
R0702:Notch4 UTSW 17 34575203 missense probably damaging 1.00
R0763:Notch4 UTSW 17 34565332 nonsense probably null
R0854:Notch4 UTSW 17 34568572 missense probably damaging 1.00
R1082:Notch4 UTSW 17 34587390 missense probably damaging 1.00
R1196:Notch4 UTSW 17 34568863 missense probably damaging 1.00
R1316:Notch4 UTSW 17 34567470 missense probably damaging 1.00
R1493:Notch4 UTSW 17 34567682 nonsense probably null
R1527:Notch4 UTSW 17 34565744 missense probably damaging 1.00
R1548:Notch4 UTSW 17 34568422 missense probably damaging 1.00
R1718:Notch4 UTSW 17 34576763 splice site probably benign
R1855:Notch4 UTSW 17 34580962 missense probably benign 0.05
R1988:Notch4 UTSW 17 34587588 missense possibly damaging 0.59
R2022:Notch4 UTSW 17 34587528 missense probably damaging 1.00
R2023:Notch4 UTSW 17 34587528 missense probably damaging 1.00
R2078:Notch4 UTSW 17 34568715 critical splice acceptor site probably null
R2369:Notch4 UTSW 17 34585950 missense probably benign 0.15
R3846:Notch4 UTSW 17 34578097 missense probably damaging 1.00
R3874:Notch4 UTSW 17 34578069 nonsense probably null
R4087:Notch4 UTSW 17 34584435 missense probably damaging 1.00
R4456:Notch4 UTSW 17 34583833 missense probably damaging 0.99
R4628:Notch4 UTSW 17 34570185 missense probably damaging 1.00
R4728:Notch4 UTSW 17 34570205 missense probably benign 0.00
R4778:Notch4 UTSW 17 34582511 missense possibly damaging 0.95
R4818:Notch4 UTSW 17 34578716 splice site probably benign
R4828:Notch4 UTSW 17 34570060 missense probably damaging 1.00
R4830:Notch4 UTSW 17 34570118 missense probably damaging 1.00
R4859:Notch4 UTSW 17 34587180 missense probably damaging 1.00
R4871:Notch4 UTSW 17 34577562 missense possibly damaging 0.63
R5090:Notch4 UTSW 17 34580920 missense probably damaging 0.99
R5290:Notch4 UTSW 17 34565289 missense probably benign 0.01
R5363:Notch4 UTSW 17 34587123 missense probably damaging 1.00
R5860:Notch4 UTSW 17 34582418 missense probably damaging 1.00
R6352:Notch4 UTSW 17 34567461 missense probably damaging 1.00
R6385:Notch4 UTSW 17 34573814 missense probably null 0.16
R6422:Notch4 UTSW 17 34584559 missense probably benign
R6645:Notch4 UTSW 17 34587816 missense probably benign 0.00
R6836:Notch4 UTSW 17 34586100 missense probably damaging 0.96
R6943:Notch4 UTSW 17 34583603 missense probably benign
R6991:Notch4 UTSW 17 34584800 nonsense probably null
R7078:Notch4 UTSW 17 34582546 missense possibly damaging 0.94
R7168:Notch4 UTSW 17 34572693 missense probably benign 0.05
R7182:Notch4 UTSW 17 34583499 missense probably damaging 1.00
R7247:Notch4 UTSW 17 34572517 missense probably damaging 1.00
R7556:Notch4 UTSW 17 34575470 missense not run
R7571:Notch4 UTSW 17 34583574 missense not run
X0054:Notch4 UTSW 17 34584495 missense probably damaging 1.00
X0067:Notch4 UTSW 17 34586084 nonsense probably null
Z1088:Notch4 UTSW 17 34587915 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACATGTACAGAATCCTGCC -3'
(R):5'- GAAAGTCTGTTCTGGGAGACTG -3'

Sequencing Primer
(F):5'- CCTGCCATATAATATAAAGTTGT -3'
(R):5'- AGGCAACAGGTGTGGTTG -3'
Posted On2019-06-26