Incidental Mutation 'R7241:Lrriq1'
ID563219
Institutional Source Beutler Lab
Gene Symbol Lrriq1
Ensembl Gene ENSMUSG00000019892
Gene Nameleucine-rich repeats and IQ motif containing 1
SynonymsLOC380658, 4930503E15Rik, Gm1557
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R7241 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location103046031-103236322 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 103215973 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 306 (V306G)
Ref Sequence ENSEMBL: ENSMUSP00000020043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020043] [ENSMUST00000123364] [ENSMUST00000166240]
Predicted Effect probably damaging
Transcript: ENSMUST00000020043
AA Change: V306G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000020043
Gene: ENSMUSG00000019892
AA Change: V306G

DomainStartEndE-ValueType
coiled coil region 11 31 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
coiled coil region 183 286 N/A INTRINSIC
Blast:IQ 290 312 1e-6 BLAST
coiled coil region 314 390 N/A INTRINSIC
low complexity region 550 559 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000123364
AA Change: V306G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119783
Gene: ENSMUSG00000019892
AA Change: V306G

DomainStartEndE-ValueType
coiled coil region 11 31 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
coiled coil region 183 286 N/A INTRINSIC
Blast:IQ 290 312 6e-6 BLAST
coiled coil region 314 390 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166240
AA Change: V306G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131419
Gene: ENSMUSG00000019892
AA Change: V306G

DomainStartEndE-ValueType
coiled coil region 11 31 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
coiled coil region 183 286 N/A INTRINSIC
IQ 290 312 9.78e1 SMART
coiled coil region 314 390 N/A INTRINSIC
low complexity region 550 559 N/A INTRINSIC
LRR 873 894 2.14e1 SMART
LRR 895 917 4.45e1 SMART
LRR 984 1005 2.03e2 SMART
LRR 1029 1052 3.65e0 SMART
low complexity region 1244 1258 N/A INTRINSIC
IQ 1279 1301 5.61e1 SMART
IQ 1339 1361 6.7e-3 SMART
low complexity region 1369 1394 N/A INTRINSIC
low complexity region 1502 1518 N/A INTRINSIC
low complexity region 1528 1543 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,287,042 E3378G probably benign Het
Abca14 A G 7: 120,246,961 T612A probably damaging Het
Acacb G A 5: 114,245,100 A2115T possibly damaging Het
Adam32 T C 8: 24,898,494 K398R probably benign Het
Adam9 T A 8: 24,950,986 I824F possibly damaging Het
Ahnak A G 19: 9,009,031 I2560V possibly damaging Het
Ank3 G A 10: 69,706,814 M1I probably null Het
Anks1b T G 10: 90,512,837 I789S probably damaging Het
Ap2b1 T A 11: 83,351,105 N641K probably benign Het
Arhgap33 A G 7: 30,528,721 L412P probably damaging Het
Atp13a3 T A 16: 30,352,277 M317L possibly damaging Het
B4galt5 A G 2: 167,306,697 L167P probably damaging Het
Bace2 T C 16: 97,436,798 I483T possibly damaging Het
C2cd3 A C 7: 100,407,050 K177T Het
Ccr4 T C 9: 114,492,956 T14A probably benign Het
Cep250 A T 2: 155,991,552 H1799L probably benign Het
Cgnl1 T C 9: 71,724,770 Q433R probably benign Het
Copb1 C T 7: 114,237,356 V384M probably damaging Het
Cyp2c50 T A 19: 40,090,568 N118K probably benign Het
Cyp4a32 A G 4: 115,602,302 I78V probably benign Het
Cyth4 A G 15: 78,607,045 K108R probably benign Het
Dnah1 T C 14: 31,264,939 H3632R probably benign Het
Dnah3 T C 7: 119,943,633 I540V probably benign Het
Dock4 A G 12: 40,794,860 Y1174C probably damaging Het
Drd5 A G 5: 38,320,536 T291A probably damaging Het
Fam102a A G 2: 32,558,064 R62G probably benign Het
Fbn1 T C 2: 125,306,495 N2611S possibly damaging Het
Fhod3 A G 18: 25,060,352 E640G probably damaging Het
Flvcr2 T A 12: 85,805,239 D522E probably benign Het
Fuk A G 8: 110,895,897 I133T probably benign Het
Ganc T A 2: 120,441,529 I556K probably damaging Het
Gjc2 T A 11: 59,177,134 E174V unknown Het
Gm4869 A G 5: 140,462,188 T137A probably damaging Het
Gzmd G A 14: 56,131,342 R32C probably damaging Het
Hltf T A 3: 20,065,392 H200Q probably benign Het
Hrasls5 A G 19: 7,614,581 T121A probably benign Het
Ift88 A G 14: 57,479,997 I559M probably damaging Het
Ighv1-62-1 C A 12: 115,386,702 C115F probably damaging Het
Impdh2 A G 9: 108,563,437 N279S possibly damaging Het
Itpr1 T C 6: 108,517,620 probably null Het
Kansl1l T C 1: 66,801,628 N171S possibly damaging Het
Kif14 T A 1: 136,468,753 C266S probably benign Het
Mast4 G A 13: 103,334,000 R65W possibly damaging Het
Mex3d T C 10: 80,387,257 D55G Het
Mrps27 A T 13: 99,411,280 K233* probably null Het
Myo1f A G 17: 33,579,928 N189S probably damaging Het
Nbn A T 4: 15,991,190 K729N probably benign Het
Olfr1082 C A 2: 86,594,154 V225F possibly damaging Het
Olfr395 T C 11: 73,907,232 S87G probably benign Het
Park2 C A 17: 11,854,861 N355K possibly damaging Het
Pgghg T C 7: 140,945,720 S479P Het
Polr1e A C 4: 45,029,340 H315P probably damaging Het
Pou6f2 A G 13: 18,125,289 V595A Het
Prdm15 T C 16: 97,795,741 D960G possibly damaging Het
Prkcz A T 4: 155,269,059 M460K probably benign Het
Prkd2 G T 7: 16,857,805 R587L probably benign Het
Rabep1 C A 11: 70,939,989 T829N probably damaging Het
Rptn A G 3: 93,395,954 E198G probably benign Het
Ryr2 A T 13: 11,665,913 I3182N possibly damaging Het
Sectm1a T A 11: 121,069,882 I36F possibly damaging Het
Sez6l T C 5: 112,473,480 S243G probably benign Het
Taf2 T A 15: 55,062,141 H235L probably benign Het
Tbc1d7 T C 13: 43,153,017 Q161R probably benign Het
Tfcp2 T C 15: 100,518,587 T271A possibly damaging Het
Thrsp G T 7: 97,417,088 T139K probably damaging Het
Timm10 T A 2: 84,829,989 *91R probably null Het
Tlr11 T A 14: 50,362,141 I528N possibly damaging Het
Tnnt2 T A 1: 135,851,706 L278Q probably damaging Het
Toe1 A T 4: 116,807,518 M1K probably null Het
Trpv5 G A 6: 41,675,308 R148* probably null Het
Ttll13 A C 7: 80,254,163 K280Q probably damaging Het
Ttn A G 2: 76,953,206 V860A unknown Het
Txnip T C 3: 96,559,675 Y222H probably damaging Het
Ubr4 G A 4: 139,443,414 S1600N probably damaging Het
Uhrf1 T C 17: 56,315,193 Y364H probably damaging Het
Unc5a A T 13: 54,991,020 T71S probably damaging Het
Vmn1r123 A T 7: 21,162,612 Y143F possibly damaging Het
Vmn1r180 T A 7: 23,952,466 I18N probably damaging Het
Washc2 A G 6: 116,208,207 M1V probably null Het
Zfp174 C A 16: 3,848,247 H125Q probably benign Het
Zfpl1 T C 19: 6,081,913 H227R possibly damaging Het
Other mutations in Lrriq1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Lrriq1 APN 10 103161896 missense probably damaging 0.99
IGL01523:Lrriq1 APN 10 103218116 nonsense probably null
IGL01637:Lrriq1 APN 10 103215628 missense probably benign
IGL02019:Lrriq1 APN 10 103178800 missense probably benign 0.02
IGL02153:Lrriq1 APN 10 103170479 missense probably benign 0.01
IGL02341:Lrriq1 APN 10 103224941 missense probably benign 0.03
IGL02343:Lrriq1 APN 10 103234163 splice site probably benign
IGL02408:Lrriq1 APN 10 103146281 missense probably benign 0.17
IGL02431:Lrriq1 APN 10 103200639 missense probably damaging 1.00
IGL02540:Lrriq1 APN 10 103215019 missense probably benign 0.02
IGL02558:Lrriq1 APN 10 103146283 missense probably damaging 1.00
IGL02613:Lrriq1 APN 10 103144548 missense probably damaging 0.99
IGL02642:Lrriq1 APN 10 103221461 critical splice acceptor site probably null
IGL03027:Lrriq1 APN 10 103227196 missense probably benign 0.35
PIT4362001:Lrriq1 UTSW 10 103071194 missense probably benign 0.26
R0050:Lrriq1 UTSW 10 103068931 missense probably damaging 0.99
R0050:Lrriq1 UTSW 10 103068931 missense probably damaging 0.99
R0068:Lrriq1 UTSW 10 103063418 missense probably benign 0.02
R0068:Lrriq1 UTSW 10 103063418 missense probably benign 0.02
R0124:Lrriq1 UTSW 10 103170420 critical splice donor site probably null
R0244:Lrriq1 UTSW 10 103215773 missense probably damaging 0.98
R0323:Lrriq1 UTSW 10 103221289 missense possibly damaging 0.91
R0515:Lrriq1 UTSW 10 103068968 splice site probably null
R0522:Lrriq1 UTSW 10 103161777 missense probably damaging 0.99
R0701:Lrriq1 UTSW 10 103234044 missense probably benign
R1220:Lrriq1 UTSW 10 103071129 missense probably benign 0.05
R1261:Lrriq1 UTSW 10 103234137 missense possibly damaging 0.87
R1262:Lrriq1 UTSW 10 103234137 missense possibly damaging 0.87
R1451:Lrriq1 UTSW 10 103202515 splice site probably benign
R1642:Lrriq1 UTSW 10 103214456 missense probably benign 0.13
R1643:Lrriq1 UTSW 10 103214824 missense probably benign 0.00
R1647:Lrriq1 UTSW 10 103170648 nonsense probably null
R1830:Lrriq1 UTSW 10 103161759 missense probably benign
R1843:Lrriq1 UTSW 10 103227173 splice site probably null
R2128:Lrriq1 UTSW 10 103214857 missense probably benign 0.01
R2129:Lrriq1 UTSW 10 103214857 missense probably benign 0.01
R2199:Lrriq1 UTSW 10 103068913 missense probably damaging 1.00
R2354:Lrriq1 UTSW 10 103189987 missense probably damaging 1.00
R2495:Lrriq1 UTSW 10 103202381 missense probably damaging 0.97
R2897:Lrriq1 UTSW 10 103227250 missense probably damaging 0.99
R2898:Lrriq1 UTSW 10 103227250 missense probably damaging 0.99
R2922:Lrriq1 UTSW 10 103214675 missense probably benign 0.00
R2939:Lrriq1 UTSW 10 103144889 missense probably damaging 0.98
R2965:Lrriq1 UTSW 10 103214900 missense probably benign 0.07
R2966:Lrriq1 UTSW 10 103214900 missense probably benign 0.07
R3081:Lrriq1 UTSW 10 103144889 missense probably damaging 0.98
R3115:Lrriq1 UTSW 10 103170433 missense probably benign 0.00
R3745:Lrriq1 UTSW 10 103170856 missense probably damaging 0.99
R3813:Lrriq1 UTSW 10 103216111 missense probably damaging 1.00
R3814:Lrriq1 UTSW 10 103216111 missense probably damaging 1.00
R3885:Lrriq1 UTSW 10 103216106 missense probably damaging 0.96
R4378:Lrriq1 UTSW 10 103202364 missense probably damaging 1.00
R4632:Lrriq1 UTSW 10 103221427 missense probably damaging 1.00
R4633:Lrriq1 UTSW 10 103200563 nonsense probably null
R4663:Lrriq1 UTSW 10 103063412 missense possibly damaging 0.88
R4702:Lrriq1 UTSW 10 103215749 missense possibly damaging 0.65
R4793:Lrriq1 UTSW 10 103170466 missense probably benign 0.25
R4801:Lrriq1 UTSW 10 103221318 missense probably benign 0.02
R4802:Lrriq1 UTSW 10 103221318 missense probably benign 0.02
R4815:Lrriq1 UTSW 10 103144878 missense probably benign 0.10
R4872:Lrriq1 UTSW 10 103178788 missense possibly damaging 0.56
R4877:Lrriq1 UTSW 10 103234038 missense possibly damaging 0.88
R4894:Lrriq1 UTSW 10 103161752 missense possibly damaging 0.86
R4990:Lrriq1 UTSW 10 103200559 missense probably damaging 1.00
R4991:Lrriq1 UTSW 10 103200559 missense probably damaging 1.00
R5011:Lrriq1 UTSW 10 103189923 missense probably damaging 1.00
R5013:Lrriq1 UTSW 10 103189923 missense probably damaging 1.00
R5122:Lrriq1 UTSW 10 103187453 missense probably damaging 1.00
R5282:Lrriq1 UTSW 10 103215345 missense probably benign 0.01
R5311:Lrriq1 UTSW 10 103214587 missense probably damaging 1.00
R5567:Lrriq1 UTSW 10 103170596 missense possibly damaging 0.56
R5643:Lrriq1 UTSW 10 103215440 missense probably benign 0.00
R5683:Lrriq1 UTSW 10 103173375 missense probably damaging 1.00
R5916:Lrriq1 UTSW 10 103221382 nonsense probably null
R6008:Lrriq1 UTSW 10 103170464 missense probably damaging 1.00
R6022:Lrriq1 UTSW 10 103215534 missense possibly damaging 0.90
R6224:Lrriq1 UTSW 10 103215757 missense probably damaging 1.00
R6254:Lrriq1 UTSW 10 103215451 missense probably benign 0.15
R6311:Lrriq1 UTSW 10 103173393 missense probably benign 0.03
R6460:Lrriq1 UTSW 10 103200698 missense probably damaging 1.00
R6502:Lrriq1 UTSW 10 103227184 missense probably damaging 0.99
R6637:Lrriq1 UTSW 10 103221432 missense probably benign 0.06
R6719:Lrriq1 UTSW 10 103071116 missense probably damaging 1.00
R6736:Lrriq1 UTSW 10 103181889 critical splice acceptor site probably null
R6928:Lrriq1 UTSW 10 103214939 missense possibly damaging 0.95
R6991:Lrriq1 UTSW 10 103187458 missense probably damaging 1.00
R7174:Lrriq1 UTSW 10 103224965 missense probably benign
R7248:Lrriq1 UTSW 10 103223750 missense possibly damaging 0.85
R7287:Lrriq1 UTSW 10 103216016 missense probably benign 0.00
X0026:Lrriq1 UTSW 10 103215704 nonsense probably null
Z1088:Lrriq1 UTSW 10 103202446 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAGGTAATGATCAGTGGCG -3'
(R):5'- CTAGAGCACTTTCACCCGTC -3'

Sequencing Primer
(F):5'- AGTGGGCATGTTCCCTCAGTC -3'
(R):5'- TAGAGCACTTTCACCCGTCATTTAGG -3'
Posted On2019-06-26