Mutagenetix > Incidental Mutation

Incidental Mutation 'R7241:Ryr2'

563228

Institutional Source

Beutler Lab

Gene Symbol

Ryr2

Ensembl Gene

ENSMUSG00000021313

Gene Name

ryanodine receptor 2, cardiac

Synonyms

9330127I20Rik

MMRRC Submission

045348-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7241 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

11567988-12121831 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 11680799 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 3182 (I3182N)

Ref Sequence

ENSEMBL: ENSMUSP00000021750 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021750] [ENSMUST00000170156]

AlphaFold

no structure available at present

PDB Structure

X-ray crystallography-solution NMR hybrid structure of mouse RyR2 domain A [SOLUTION NMR]
Crystal structure of mouse Ryanodine Receptor 2 (residues 1-217) [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 mutant V186M [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 N-terminal domain (1-217) disease mutant A77V [X-RAY DIFFRACTION]
Structure of the first domain of a cardiac Ryanodine Receptor mutant with exon 3 deleted [X-RAY DIFFRACTION]
Crystal structure of mouse ryanodine receptor 2 (2699-2904) [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 (1-217) disease mutant P164S [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 (1-217) disease mutant R169Q [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 (1-217) disease mutant R176Q [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor isoform 2 (RyR2) 1-547 [X-RAY DIFFRACTION]
>> 3 additional structures at PDB <<

Predicted Effect

possibly damaging
Transcript: ENSMUST00000021750
AA Change: I3182N

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000021750
Gene: ENSMUSG00000021313
AA Change: I3182N

Domain	Start	End	E-Value	Type
MIR	110	165	4.19e-2	SMART
MIR	172	217	9.25e-4	SMART
MIR	225	280	1.8e-1	SMART
MIR	286	376	2.22e-24	SMART
Pfam:RYDR_ITPR	454	648	3.1e-65	PFAM
SPRY	670	808	1.56e-30	SMART
Pfam:RyR	862	952	1.8e-36	PFAM
Pfam:RyR	976	1066	1.1e-32	PFAM
SPRY	1098	1221	5.07e-39	SMART
SPRY	1423	1562	7.47e-28	SMART
low complexity region	1643	1653	N/A	INTRINSIC
low complexity region	1872	1891	N/A	INTRINSIC
Pfam:RYDR_ITPR	2122	2331	1.2e-71	PFAM
low complexity region	2372	2379	N/A	INTRINSIC
low complexity region	2416	2426	N/A	INTRINSIC
low complexity region	2497	2510	N/A	INTRINSIC
Pfam:RyR	2700	2790	1.1e-33	PFAM
Pfam:RyR	2820	2904	7.1e-27	PFAM
PDB:2BCX\|B	3580	3609	9e-12	PDB
low complexity region	3700	3720	N/A	INTRINSIC
Pfam:RIH_assoc	3829	3947	3.1e-36	PFAM
EFh	4026	4054	1.36e0	SMART
EFh	4061	4089	5.92e1	SMART
low complexity region	4218	4227	N/A	INTRINSIC
low complexity region	4256	4273	N/A	INTRINSIC
transmembrane domain	4278	4300	N/A	INTRINSIC
low complexity region	4309	4317	N/A	INTRINSIC
Pfam:RR_TM4-6	4332	4598	5.7e-96	PFAM
Pfam:Ion_trans	4710	4877	8e-16	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000170156
AA Change: I3182N

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000127991
Gene: ENSMUSG00000021313
AA Change: I3182N

Domain	Start	End	E-Value	Type
MIR	110	165	4.19e-2	SMART
MIR	172	217	9.25e-4	SMART
MIR	225	280	1.8e-1	SMART
MIR	286	376	2.22e-24	SMART
Pfam:RYDR_ITPR	451	655	3.5e-73	PFAM
SPRY	670	808	1.56e-30	SMART
Pfam:RyR	861	955	1.4e-33	PFAM
Pfam:RyR	975	1069	9.2e-34	PFAM
SPRY	1098	1221	5.07e-39	SMART
SPRY	1423	1562	7.47e-28	SMART
low complexity region	1643	1653	N/A	INTRINSIC
low complexity region	1872	1891	N/A	INTRINSIC
Pfam:RYDR_ITPR	2120	2331	3.9e-65	PFAM
low complexity region	2372	2379	N/A	INTRINSIC
low complexity region	2416	2426	N/A	INTRINSIC
low complexity region	2497	2510	N/A	INTRINSIC
Pfam:RyR	2699	2793	1.1e-37	PFAM
Pfam:RyR	2819	2907	9.4e-34	PFAM
PDB:2BCX\|B	3580	3609	9e-12	PDB
low complexity region	3700	3720	N/A	INTRINSIC
Pfam:RIH_assoc	3825	3958	2.3e-42	PFAM
EFh	4026	4054	1.36e0	SMART
EFh	4061	4089	5.92e1	SMART
low complexity region	4218	4227	N/A	INTRINSIC
low complexity region	4256	4273	N/A	INTRINSIC
transmembrane domain	4278	4300	N/A	INTRINSIC
low complexity region	4309	4317	N/A	INTRINSIC
Pfam:RR_TM4-6	4332	4598	5.1e-93	PFAM
Pfam:Ion_trans	4705	4865	9.3e-11	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ryanodine receptor found in cardiac muscle sarcoplasmic reticulum. The encoded protein is one of the components of a calcium channel, composed of a tetramer of the ryanodine receptor proteins and a tetramer of FK506 binding protein 1B proteins, that supplies calcium to cardiac muscle. Mutations in this gene are associated with stress-induced polymorphic ventricular tachycardia and arrhythmogenic right ventricular dysplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice show embryonic lethality during organogenesis and altered cardiomyocyte morphology. Homozygotes for a phosphorylation defective allele show decreased susceptibility to myocardial infarction-induced heart failure. Homozygotes for the R420W allele show lymphoid organ hypertrophy. [provided by MGI curators]

Allele List at MGI

All alleles(44) : Targeted(17) Gene trapped(27)

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	A	G	7: 119,846,184 (GRCm39)	T612A	probably damaging	Het
Acacb	G	A	5: 114,383,161 (GRCm39)	A2115T	possibly damaging	Het
Adam32	T	C	8: 25,388,510 (GRCm39)	K398R	probably benign	Het
Adam9	T	A	8: 25,441,002 (GRCm39)	I824F	possibly damaging	Het
Ahnak	A	G	19: 8,986,395 (GRCm39)	I2560V	possibly damaging	Het
Ank3	G	A	10: 69,542,644 (GRCm39)	M1I	probably null	Het
Anks1b	T	G	10: 90,348,699 (GRCm39)	I789S	probably damaging	Het
Ap2b1	T	A	11: 83,241,931 (GRCm39)	N641K	probably benign	Het
Arhgap33	A	G	7: 30,228,146 (GRCm39)	L412P	probably damaging	Het
Atp13a3	T	A	16: 30,171,095 (GRCm39)	M317L	possibly damaging	Het
B4galt5	A	G	2: 167,148,617 (GRCm39)	L167P	probably damaging	Het
Bace2	T	C	16: 97,237,998 (GRCm39)	I483T	possibly damaging	Het
C2cd3	A	C	7: 100,056,257 (GRCm39)	K177T		Het
Ccr4	T	C	9: 114,322,024 (GRCm39)	T14A	probably benign	Het
Cep250	A	T	2: 155,833,472 (GRCm39)	H1799L	probably benign	Het
Cgnl1	T	C	9: 71,632,052 (GRCm39)	Q433R	probably benign	Het
Copb1	C	T	7: 113,836,591 (GRCm39)	V384M	probably damaging	Het
Cyp2c50	T	A	19: 40,079,012 (GRCm39)	N118K	probably benign	Het
Cyp4a32	A	G	4: 115,459,499 (GRCm39)	I78V	probably benign	Het
Cyth4	A	G	15: 78,491,245 (GRCm39)	K108R	probably benign	Het
Dnah1	T	C	14: 30,986,896 (GRCm39)	H3632R	probably benign	Het
Dnah3	T	C	7: 119,542,856 (GRCm39)	I540V	probably benign	Het
Dock4	A	G	12: 40,844,859 (GRCm39)	Y1174C	probably damaging	Het
Drd5	A	G	5: 38,477,879 (GRCm39)	T291A	probably damaging	Het
Eeig1	A	G	2: 32,448,076 (GRCm39)	R62G	probably benign	Het
Fbn1	T	C	2: 125,148,415 (GRCm39)	N2611S	possibly damaging	Het
Fcsk	A	G	8: 111,622,529 (GRCm39)	I133T	probably benign	Het
Fhod3	A	G	18: 25,193,409 (GRCm39)	E640G	probably damaging	Het
Flvcr2	T	A	12: 85,852,013 (GRCm39)	D522E	probably benign	Het
Ganc	T	A	2: 120,272,010 (GRCm39)	I556K	probably damaging	Het
Gjc2	T	A	11: 59,067,960 (GRCm39)	E174V	unknown	Het
Gzmd	G	A	14: 56,368,799 (GRCm39)	R32C	probably damaging	Het
Hltf	T	A	3: 20,119,556 (GRCm39)	H200Q	probably benign	Het
Ift88	A	G	14: 57,717,454 (GRCm39)	I559M	probably damaging	Het
Ighv1-62-1	C	A	12: 115,350,322 (GRCm39)	C115F	probably damaging	Het
Impdh2	A	G	9: 108,440,636 (GRCm39)	N279S	possibly damaging	Het
Itpr1	T	C	6: 108,494,581 (GRCm39)		probably null	Het
Kansl1l	T	C	1: 66,840,787 (GRCm39)	N171S	possibly damaging	Het
Kif14	T	A	1: 136,396,491 (GRCm39)	C266S	probably benign	Het
Kif19b	A	G	5: 140,447,943 (GRCm39)	T137A	probably damaging	Het
Lrriq1	A	C	10: 103,051,834 (GRCm39)	V306G	probably damaging	Het
Mast4	G	A	13: 103,470,508 (GRCm39)	R65W	possibly damaging	Het
Mex3d	T	C	10: 80,223,091 (GRCm39)	D55G		Het
Mrps27	A	T	13: 99,547,788 (GRCm39)	K233*	probably null	Het
Myo1f	A	G	17: 33,798,902 (GRCm39)	N189S	probably damaging	Het
Nbn	A	T	4: 15,991,190 (GRCm39)	K729N	probably benign	Het
Or1e35	T	C	11: 73,798,058 (GRCm39)	S87G	probably benign	Het
Or8k35	C	A	2: 86,424,498 (GRCm39)	V225F	possibly damaging	Het
Pgghg	T	C	7: 140,525,633 (GRCm39)	S479P		Het
Plaat5	A	G	19: 7,591,946 (GRCm39)	T121A	probably benign	Het
Polr1e	A	C	4: 45,029,340 (GRCm39)	H315P	probably damaging	Het
Pou6f2	A	G	13: 18,299,874 (GRCm39)	V595A		Het
Prdm15	T	C	16: 97,596,941 (GRCm39)	D960G	possibly damaging	Het
Prkcz	A	T	4: 155,353,516 (GRCm39)	M460K	probably benign	Het
Prkd2	G	T	7: 16,591,730 (GRCm39)	R587L	probably benign	Het
Prkn	C	A	17: 12,073,748 (GRCm39)	N355K	possibly damaging	Het
Rabep1	C	A	11: 70,830,815 (GRCm39)	T829N	probably damaging	Het
Rptn	A	G	3: 93,303,261 (GRCm39)	E198G	probably benign	Het
Sectm1a	T	A	11: 120,960,708 (GRCm39)	I36F	possibly damaging	Het
Sez6l	T	C	5: 112,621,346 (GRCm39)	S243G	probably benign	Het
Spata31h1	T	C	10: 82,122,876 (GRCm39)	E3378G	probably benign	Het
Taf2	T	A	15: 54,925,537 (GRCm39)	H235L	probably benign	Het
Tbc1d7	T	C	13: 43,306,493 (GRCm39)	Q161R	probably benign	Het
Tfcp2	T	C	15: 100,416,468 (GRCm39)	T271A	possibly damaging	Het
Thrsp	G	T	7: 97,066,295 (GRCm39)	T139K	probably damaging	Het
Timm10	T	A	2: 84,660,333 (GRCm39)	*91R	probably null	Het
Tlr11	T	A	14: 50,599,598 (GRCm39)	I528N	possibly damaging	Het
Tnnt2	T	A	1: 135,779,444 (GRCm39)	L278Q	probably damaging	Het
Toe1	A	T	4: 116,664,715 (GRCm39)	M1K	probably null	Het
Trpv5	G	A	6: 41,652,242 (GRCm39)	R148*	probably null	Het
Ttll13	A	C	7: 79,903,911 (GRCm39)	K280Q	probably damaging	Het
Ttn	A	G	2: 76,783,550 (GRCm39)	V860A	unknown	Het
Txnip	T	C	3: 96,466,991 (GRCm39)	Y222H	probably damaging	Het
Ubr4	G	A	4: 139,170,725 (GRCm39)	S1600N	probably damaging	Het
Uhrf1	T	C	17: 56,622,193 (GRCm39)	Y364H	probably damaging	Het
Unc5a	A	T	13: 55,138,833 (GRCm39)	T71S	probably damaging	Het
Vmn1r123	A	T	7: 20,896,537 (GRCm39)	Y143F	possibly damaging	Het
Vmn1r180	T	A	7: 23,651,891 (GRCm39)	I18N	probably damaging	Het
Washc2	A	G	6: 116,185,168 (GRCm39)	M1V	probably null	Het
Zfp174	C	A	16: 3,666,111 (GRCm39)	H125Q	probably benign	Het
Zfpl1	T	C	19: 6,131,943 (GRCm39)	H227R	possibly damaging	Het

Other mutations in Ryr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00518:Ryr2	APN	13	11,848,978 (GRCm39)	splice site	probably benign
IGL00757:Ryr2	APN	13	11,633,490 (GRCm39)	splice site	probably null
IGL00838:Ryr2	APN	13	11,583,389 (GRCm39)	missense	probably damaging	0.98
IGL00849:Ryr2	APN	13	11,600,364 (GRCm39)	missense	possibly damaging	0.91
IGL00987:Ryr2	APN	13	11,750,388 (GRCm39)	missense	probably damaging	0.99
IGL01096:Ryr2	APN	13	11,718,430 (GRCm39)	missense	probably damaging	1.00
IGL01313:Ryr2	APN	13	11,653,371 (GRCm39)	critical splice acceptor site	probably null
IGL01349:Ryr2	APN	13	11,602,125 (GRCm39)	missense	possibly damaging	0.93
IGL01391:Ryr2	APN	13	11,571,571 (GRCm39)	missense	possibly damaging	0.96
IGL01401:Ryr2	APN	13	11,606,238 (GRCm39)	missense	possibly damaging	0.80
IGL01412:Ryr2	APN	13	11,756,922 (GRCm39)	missense	probably benign	0.10
IGL01419:Ryr2	APN	13	11,814,723 (GRCm39)	missense	possibly damaging	0.51
IGL01432:Ryr2	APN	13	11,866,090 (GRCm39)	missense	possibly damaging	0.63
IGL01533:Ryr2	APN	13	11,736,676 (GRCm39)	missense	probably damaging	1.00
IGL01571:Ryr2	APN	13	11,736,647 (GRCm39)	missense	probably damaging	1.00
IGL01584:Ryr2	APN	13	11,616,644 (GRCm39)	critical splice donor site	probably null
IGL01611:Ryr2	APN	13	11,606,202 (GRCm39)	missense	possibly damaging	0.67
IGL01632:Ryr2	APN	13	11,609,854 (GRCm39)	missense	probably damaging	0.97
IGL01643:Ryr2	APN	13	11,707,563 (GRCm39)	missense	possibly damaging	0.94
IGL01647:Ryr2	APN	13	11,600,366 (GRCm39)	missense	probably damaging	1.00
IGL01730:Ryr2	APN	13	11,616,728 (GRCm39)	missense	possibly damaging	0.86
IGL01834:Ryr2	APN	13	11,610,311 (GRCm39)	missense	possibly damaging	0.71
IGL01921:Ryr2	APN	13	11,569,436 (GRCm39)	missense	possibly damaging	0.96
IGL01937:Ryr2	APN	13	11,805,249 (GRCm39)	missense	probably damaging	1.00
IGL01945:Ryr2	APN	13	11,805,249 (GRCm39)	missense	probably damaging	1.00
IGL02027:Ryr2	APN	13	11,611,998 (GRCm39)	missense	probably damaging	1.00
IGL02060:Ryr2	APN	13	11,762,450 (GRCm39)	missense	probably damaging	1.00
IGL02065:Ryr2	APN	13	11,587,143 (GRCm39)	missense	possibly damaging	0.92
IGL02084:Ryr2	APN	13	11,807,648 (GRCm39)	nonsense	probably null
IGL02086:Ryr2	APN	13	11,750,442 (GRCm39)	missense	probably damaging	1.00
IGL02095:Ryr2	APN	13	11,774,645 (GRCm39)	missense	probably damaging	0.98
IGL02100:Ryr2	APN	13	11,752,759 (GRCm39)	missense	possibly damaging	0.92
IGL02122:Ryr2	APN	13	11,756,755 (GRCm39)	missense	probably damaging	1.00
IGL02202:Ryr2	APN	13	11,745,274 (GRCm39)	missense	probably damaging	0.97
IGL02202:Ryr2	APN	13	11,762,544 (GRCm39)	splice site	probably benign
IGL02369:Ryr2	APN	13	11,634,382 (GRCm39)	missense	possibly damaging	0.68
IGL02383:Ryr2	APN	13	11,737,607 (GRCm39)	splice site	probably benign
IGL02400:Ryr2	APN	13	11,620,130 (GRCm39)	splice site	probably benign
IGL02423:Ryr2	APN	13	11,760,084 (GRCm39)	missense	probably damaging	1.00
IGL02425:Ryr2	APN	13	11,760,560 (GRCm39)	missense	probably damaging	0.99
IGL02458:Ryr2	APN	13	11,720,585 (GRCm39)	missense	probably benign	0.15
IGL02602:Ryr2	APN	13	11,569,397 (GRCm39)	utr 3 prime	probably benign
IGL02694:Ryr2	APN	13	11,620,075 (GRCm39)	missense	probably damaging	1.00
IGL02726:Ryr2	APN	13	11,753,206 (GRCm39)	missense	probably damaging	1.00
IGL02747:Ryr2	APN	13	11,670,563 (GRCm39)	missense	probably damaging	1.00
IGL02795:Ryr2	APN	13	11,610,076 (GRCm39)	missense	probably benign	0.21
IGL02876:Ryr2	APN	13	11,722,679 (GRCm39)	missense	probably benign	0.39
IGL02878:Ryr2	APN	13	11,933,205 (GRCm39)	missense	probably benign	0.10
IGL02887:Ryr2	APN	13	11,606,155 (GRCm39)	missense	probably damaging	0.97
IGL02926:Ryr2	APN	13	11,774,721 (GRCm39)	missense	probably damaging	0.99
IGL03030:Ryr2	APN	13	11,699,365 (GRCm39)	missense	probably damaging	0.99
IGL03064:Ryr2	APN	13	11,658,788 (GRCm39)	critical splice acceptor site	probably null
IGL03102:Ryr2	APN	13	11,650,468 (GRCm39)	splice site	probably benign
IGL03152:Ryr2	APN	13	11,868,036 (GRCm39)	missense	probably damaging	1.00
IGL03176:Ryr2	APN	13	11,756,909 (GRCm39)	nonsense	probably null
IGL03180:Ryr2	APN	13	11,583,449 (GRCm39)	missense	possibly damaging	0.95
IGL03213:Ryr2	APN	13	11,739,273 (GRCm39)	splice site	probably benign
IGL03390:Ryr2	APN	13	11,787,302 (GRCm39)	missense	probably benign
IGL03410:Ryr2	APN	13	11,603,033 (GRCm39)	missense	probably damaging	0.99
Arruda	UTSW	13	11,658,781 (GRCm39)	missense	probably damaging	1.00
Arruda2	UTSW	13	11,894,382 (GRCm39)	missense	probably damaging	1.00
Arruda3	UTSW	13	11,570,334 (GRCm39)	missense	possibly damaging	0.91
barricuda	UTSW	13	11,609,900 (GRCm39)	missense	probably benign	0.06
BB006:Ryr2	UTSW	13	11,705,181 (GRCm39)	nonsense	probably null
BB006:Ryr2	UTSW	13	11,609,680 (GRCm39)	missense	probably damaging	1.00
BB016:Ryr2	UTSW	13	11,705,181 (GRCm39)	nonsense	probably null
BB016:Ryr2	UTSW	13	11,609,680 (GRCm39)	missense	probably damaging	1.00
H8562:Ryr2	UTSW	13	11,732,027 (GRCm39)	splice site	probably benign
IGL02799:Ryr2	UTSW	13	11,680,848 (GRCm39)	missense	probably damaging	1.00
IGL02991:Ryr2	UTSW	13	11,776,192 (GRCm39)	missense	probably damaging	0.99
PIT4142001:Ryr2	UTSW	13	11,722,682 (GRCm39)	missense	probably damaging	0.97
PIT4260001:Ryr2	UTSW	13	11,609,641 (GRCm39)	missense	possibly damaging	0.93
PIT4458001:Ryr2	UTSW	13	11,570,334 (GRCm39)	missense	probably benign	0.29
R0003:Ryr2	UTSW	13	11,839,265 (GRCm39)	missense	probably damaging	1.00
R0004:Ryr2	UTSW	13	11,680,805 (GRCm39)	missense	probably benign
R0018:Ryr2	UTSW	13	11,610,109 (GRCm39)	missense	possibly damaging	0.94
R0048:Ryr2	UTSW	13	11,610,670 (GRCm39)	missense	probably damaging	1.00
R0048:Ryr2	UTSW	13	11,610,670 (GRCm39)	missense	probably damaging	1.00
R0056:Ryr2	UTSW	13	11,683,924 (GRCm39)	missense	probably damaging	0.97
R0062:Ryr2	UTSW	13	11,884,002 (GRCm39)	critical splice donor site	probably null
R0062:Ryr2	UTSW	13	11,884,002 (GRCm39)	critical splice donor site	probably null
R0080:Ryr2	UTSW	13	11,583,361 (GRCm39)	missense	probably damaging	0.98
R0116:Ryr2	UTSW	13	11,724,807 (GRCm39)	missense	probably damaging	1.00
R0148:Ryr2	UTSW	13	11,729,434 (GRCm39)	missense	probably damaging	1.00
R0206:Ryr2	UTSW	13	11,691,137 (GRCm39)	splice site	probably benign
R0226:Ryr2	UTSW	13	11,787,442 (GRCm39)	missense	probably damaging	1.00
R0285:Ryr2	UTSW	13	11,731,863 (GRCm39)	missense	probably damaging	1.00
R0365:Ryr2	UTSW	13	11,683,725 (GRCm39)	missense	possibly damaging	0.90
R0401:Ryr2	UTSW	13	11,720,570 (GRCm39)	missense	probably benign	0.45
R0415:Ryr2	UTSW	13	11,884,042 (GRCm39)	missense	probably damaging	0.97
R0418:Ryr2	UTSW	13	11,848,981 (GRCm39)	splice site	probably benign
R0558:Ryr2	UTSW	13	11,814,747 (GRCm39)	missense	probably damaging	1.00
R0558:Ryr2	UTSW	13	11,653,329 (GRCm39)	missense	probably damaging	1.00
R0574:Ryr2	UTSW	13	11,746,555 (GRCm39)	missense	probably benign	0.02
R0586:Ryr2	UTSW	13	11,650,445 (GRCm39)	missense	probably null
R0601:Ryr2	UTSW	13	11,720,519 (GRCm39)	critical splice donor site	probably null
R0610:Ryr2	UTSW	13	11,637,838 (GRCm39)	missense	probably damaging	1.00
R0648:Ryr2	UTSW	13	11,739,219 (GRCm39)	missense	possibly damaging	0.86
R0727:Ryr2	UTSW	13	11,581,771 (GRCm39)	missense	probably damaging	1.00
R0743:Ryr2	UTSW	13	11,569,415 (GRCm39)	missense	probably damaging	0.99
R0821:Ryr2	UTSW	13	11,753,012 (GRCm39)	missense	probably benign	0.35
R0884:Ryr2	UTSW	13	11,569,415 (GRCm39)	missense	probably damaging	0.99
R1104:Ryr2	UTSW	13	11,684,855 (GRCm39)	missense	probably damaging	0.99
R1114:Ryr2	UTSW	13	11,960,867 (GRCm39)	missense	probably damaging	0.98
R1167:Ryr2	UTSW	13	11,674,999 (GRCm39)	missense	possibly damaging	0.94
R1238:Ryr2	UTSW	13	11,774,589 (GRCm39)	missense	probably damaging	1.00
R1239:Ryr2	UTSW	13	11,897,929 (GRCm39)	critical splice donor site	probably null
R1296:Ryr2	UTSW	13	11,702,765 (GRCm39)	splice site	probably benign
R1400:Ryr2	UTSW	13	11,609,962 (GRCm39)	missense	probably benign	0.08
R1439:Ryr2	UTSW	13	11,729,389 (GRCm39)	splice site	probably benign
R1443:Ryr2	UTSW	13	11,794,152 (GRCm39)	missense	probably benign	0.19
R1446:Ryr2	UTSW	13	11,753,035 (GRCm39)	missense	probably benign	0.09
R1458:Ryr2	UTSW	13	11,741,908 (GRCm39)	missense	probably damaging	0.97
R1497:Ryr2	UTSW	13	11,616,727 (GRCm39)	missense	probably damaging	0.99
R1505:Ryr2	UTSW	13	11,569,478 (GRCm39)	missense	possibly damaging	0.84
R1548:Ryr2	UTSW	13	11,569,435 (GRCm39)	nonsense	probably null
R1551:Ryr2	UTSW	13	11,800,029 (GRCm39)	critical splice acceptor site	probably null
R1567:Ryr2	UTSW	13	11,774,563 (GRCm39)	missense	possibly damaging	0.87
R1581:Ryr2	UTSW	13	11,809,449 (GRCm39)	missense	probably benign	0.01
R1645:Ryr2	UTSW	13	11,733,368 (GRCm39)	nonsense	probably null
R1686:Ryr2	UTSW	13	11,618,665 (GRCm39)	splice site	probably benign
R1696:Ryr2	UTSW	13	11,746,543 (GRCm39)	missense	probably benign	0.02
R1708:Ryr2	UTSW	13	11,602,328 (GRCm39)	splice site	probably null
R1728:Ryr2	UTSW	13	11,602,308 (GRCm39)	missense	possibly damaging	0.94
R1745:Ryr2	UTSW	13	11,805,153 (GRCm39)	missense	probably damaging	1.00
R1771:Ryr2	UTSW	13	11,760,062 (GRCm39)	critical splice donor site	probably null
R1776:Ryr2	UTSW	13	11,760,062 (GRCm39)	critical splice donor site	probably null
R1783:Ryr2	UTSW	13	11,715,257 (GRCm39)	nonsense	probably null
R1801:Ryr2	UTSW	13	11,610,167 (GRCm39)	missense	probably benign	0.01
R1812:Ryr2	UTSW	13	11,575,472 (GRCm39)	missense	probably damaging	0.97
R1820:Ryr2	UTSW	13	11,602,202 (GRCm39)	missense	probably damaging	0.99
R1835:Ryr2	UTSW	13	11,784,764 (GRCm39)	missense	probably benign	0.06
R1868:Ryr2	UTSW	13	11,746,586 (GRCm39)	missense	probably benign	0.02
R1869:Ryr2	UTSW	13	11,676,961 (GRCm39)	missense	probably damaging	0.98
R1884:Ryr2	UTSW	13	11,753,242 (GRCm39)	missense	probably damaging	0.97
R1892:Ryr2	UTSW	13	11,673,844 (GRCm39)	nonsense	probably null
R1897:Ryr2	UTSW	13	11,765,818 (GRCm39)	missense	probably benign	0.09
R1899:Ryr2	UTSW	13	11,606,222 (GRCm39)	missense	probably benign
R1909:Ryr2	UTSW	13	11,715,235 (GRCm39)	missense	probably damaging	1.00
R1918:Ryr2	UTSW	13	11,571,584 (GRCm39)	missense	possibly damaging	0.91
R1937:Ryr2	UTSW	13	11,683,848 (GRCm39)	missense	probably damaging	1.00
R1943:Ryr2	UTSW	13	11,746,609 (GRCm39)	missense	probably benign	0.10
R1956:Ryr2	UTSW	13	11,695,966 (GRCm39)	missense	probably damaging	1.00
R1983:Ryr2	UTSW	13	11,600,288 (GRCm39)	splice site	probably null
R2018:Ryr2	UTSW	13	11,866,074 (GRCm39)	missense	possibly damaging	0.59
R2019:Ryr2	UTSW	13	11,866,074 (GRCm39)	missense	possibly damaging	0.59
R2060:Ryr2	UTSW	13	11,610,622 (GRCm39)	missense	probably damaging	1.00
R2061:Ryr2	UTSW	13	11,680,764 (GRCm39)	splice site	probably null
R2088:Ryr2	UTSW	13	11,677,115 (GRCm39)	missense	probably benign	0.04
R2089:Ryr2	UTSW	13	11,960,863 (GRCm39)	missense	probably benign	0.23
R2091:Ryr2	UTSW	13	11,960,863 (GRCm39)	missense	probably benign	0.23
R2091:Ryr2	UTSW	13	11,960,863 (GRCm39)	missense	probably benign	0.23
R2127:Ryr2	UTSW	13	11,727,081 (GRCm39)	missense	probably damaging	1.00
R2140:Ryr2	UTSW	13	11,575,493 (GRCm39)	missense	probably damaging	1.00
R2153:Ryr2	UTSW	13	11,592,759 (GRCm39)	missense	possibly damaging	0.86
R2179:Ryr2	UTSW	13	11,720,679 (GRCm39)	nonsense	probably null
R2207:Ryr2	UTSW	13	11,825,823 (GRCm39)	missense	probably damaging	1.00
R2237:Ryr2	UTSW	13	11,677,146 (GRCm39)	missense	probably benign	0.18
R2258:Ryr2	UTSW	13	11,753,102 (GRCm39)	missense	possibly damaging	0.94
R2312:Ryr2	UTSW	13	11,753,128 (GRCm39)	missense	probably damaging	1.00
R2421:Ryr2	UTSW	13	11,606,123 (GRCm39)	missense	probably damaging	0.98
R2438:Ryr2	UTSW	13	11,816,734 (GRCm39)	missense	probably damaging	1.00
R2483:Ryr2	UTSW	13	11,774,589 (GRCm39)	missense	probably damaging	1.00
R2860:Ryr2	UTSW	13	11,607,979 (GRCm39)	missense	probably damaging	0.98
R2861:Ryr2	UTSW	13	11,607,979 (GRCm39)	missense	probably damaging	0.98
R2867:Ryr2	UTSW	13	11,776,235 (GRCm39)	missense	probably damaging	1.00
R2867:Ryr2	UTSW	13	11,776,235 (GRCm39)	missense	probably damaging	1.00
R3618:Ryr2	UTSW	13	11,787,466 (GRCm39)	critical splice acceptor site	probably null
R3876:Ryr2	UTSW	13	11,603,045 (GRCm39)	missense	probably damaging	0.99
R3906:Ryr2	UTSW	13	11,753,095 (GRCm39)	missense	possibly damaging	0.87
R3912:Ryr2	UTSW	13	11,787,313 (GRCm39)	missense	probably damaging	0.99
R4018:Ryr2	UTSW	13	11,933,300 (GRCm39)	missense	probably damaging	1.00
R4114:Ryr2	UTSW	13	11,707,568 (GRCm39)	missense	probably damaging	1.00
R4119:Ryr2	UTSW	13	11,794,153 (GRCm39)	missense	probably benign	0.22
R4127:Ryr2	UTSW	13	11,602,323 (GRCm39)	missense	possibly damaging	0.91
R4222:Ryr2	UTSW	13	11,752,759 (GRCm39)	missense	possibly damaging	0.92
R4233:Ryr2	UTSW	13	11,765,611 (GRCm39)	missense	probably benign	0.20
R4355:Ryr2	UTSW	13	11,664,698 (GRCm39)	missense	probably benign	0.05
R4384:Ryr2	UTSW	13	11,620,119 (GRCm39)	missense	probably damaging	0.99
R4422:Ryr2	UTSW	13	11,731,952 (GRCm39)	nonsense	probably null
R4430:Ryr2	UTSW	13	11,750,413 (GRCm39)	missense	probably damaging	0.98
R4624:Ryr2	UTSW	13	12,121,301 (GRCm39)	missense	possibly damaging	0.47
R4663:Ryr2	UTSW	13	11,764,395 (GRCm39)	missense	possibly damaging	0.47
R4665:Ryr2	UTSW	13	11,765,571 (GRCm39)	splice site	probably null
R4668:Ryr2	UTSW	13	11,608,003 (GRCm39)	missense	probably benign
R4677:Ryr2	UTSW	13	11,721,553 (GRCm39)	missense	probably damaging	0.98
R4679:Ryr2	UTSW	13	11,839,255 (GRCm39)	missense	probably benign	0.34
R4680:Ryr2	UTSW	13	11,610,119 (GRCm39)	missense	probably benign	0.04
R4685:Ryr2	UTSW	13	11,707,532 (GRCm39)	missense	probably damaging	1.00
R4709:Ryr2	UTSW	13	11,731,884 (GRCm39)	missense	probably damaging	1.00
R4731:Ryr2	UTSW	13	11,592,795 (GRCm39)	missense	possibly damaging	0.53
R4732:Ryr2	UTSW	13	11,592,795 (GRCm39)	missense	possibly damaging	0.53
R4733:Ryr2	UTSW	13	11,592,795 (GRCm39)	missense	possibly damaging	0.53
R4734:Ryr2	UTSW	13	11,752,639 (GRCm39)	missense	probably damaging	0.99
R4740:Ryr2	UTSW	13	11,671,933 (GRCm39)	missense	possibly damaging	0.95
R4801:Ryr2	UTSW	13	11,723,113 (GRCm39)	missense	probably damaging	1.00
R4801:Ryr2	UTSW	13	11,702,818 (GRCm39)	missense	probably damaging	1.00
R4802:Ryr2	UTSW	13	11,702,818 (GRCm39)	missense	probably damaging	1.00
R4802:Ryr2	UTSW	13	11,723,113 (GRCm39)	missense	probably damaging	1.00
R4804:Ryr2	UTSW	13	11,731,983 (GRCm39)	missense	probably damaging	1.00
R4811:Ryr2	UTSW	13	11,670,584 (GRCm39)	missense	probably damaging	0.97
R4850:Ryr2	UTSW	13	11,760,638 (GRCm39)	missense	probably damaging	1.00
R4850:Ryr2	UTSW	13	11,683,706 (GRCm39)	missense	probably damaging	0.99
R4880:Ryr2	UTSW	13	11,767,104 (GRCm39)	missense	probably damaging	1.00
R4917:Ryr2	UTSW	13	11,609,872 (GRCm39)	missense	probably damaging	0.96
R4918:Ryr2	UTSW	13	11,609,872 (GRCm39)	missense	probably damaging	0.96
R4922:Ryr2	UTSW	13	11,724,849 (GRCm39)	missense	probably damaging	0.99
R4933:Ryr2	UTSW	13	11,960,831 (GRCm39)	missense	probably damaging	0.96
R4950:Ryr2	UTSW	13	11,756,897 (GRCm39)	missense	probably damaging	1.00
R4957:Ryr2	UTSW	13	11,799,966 (GRCm39)	missense	probably damaging	0.97
R4964:Ryr2	UTSW	13	11,848,878 (GRCm39)	missense	probably benign	0.00
R4964:Ryr2	UTSW	13	11,729,497 (GRCm39)	missense	possibly damaging	0.49
R4966:Ryr2	UTSW	13	11,729,497 (GRCm39)	missense	possibly damaging	0.49
R4966:Ryr2	UTSW	13	11,848,878 (GRCm39)	missense	probably benign	0.00
R4997:Ryr2	UTSW	13	11,610,192 (GRCm39)	missense	probably benign	0.09
R4998:Ryr2	UTSW	13	11,658,781 (GRCm39)	missense	probably damaging	1.00
R5033:Ryr2	UTSW	13	11,602,140 (GRCm39)	missense	possibly damaging	0.93
R5061:Ryr2	UTSW	13	11,650,422 (GRCm39)	missense	possibly damaging	0.74
R5062:Ryr2	UTSW	13	11,715,240 (GRCm39)	missense	probably damaging	0.97
R5088:Ryr2	UTSW	13	11,727,129 (GRCm39)	nonsense	probably null
R5135:Ryr2	UTSW	13	11,677,016 (GRCm39)	missense	probably benign	0.05
R5138:Ryr2	UTSW	13	11,675,175 (GRCm39)	missense	probably damaging	1.00
R5168:Ryr2	UTSW	13	11,767,207 (GRCm39)	missense	probably benign
R5187:Ryr2	UTSW	13	11,787,338 (GRCm39)	missense	probably damaging	0.99
R5197:Ryr2	UTSW	13	11,653,316 (GRCm39)	critical splice donor site	probably null
R5262:Ryr2	UTSW	13	11,787,323 (GRCm39)	missense	probably damaging	0.99
R5325:Ryr2	UTSW	13	11,705,249 (GRCm39)	missense	probably damaging	0.97
R5381:Ryr2	UTSW	13	11,571,544 (GRCm39)	missense	probably damaging	1.00
R5437:Ryr2	UTSW	13	11,670,599 (GRCm39)	missense	probably damaging	1.00
R5477:Ryr2	UTSW	13	11,720,542 (GRCm39)	missense	probably damaging	1.00
R5497:Ryr2	UTSW	13	11,720,587 (GRCm39)	missense	probably null	0.15
R5509:Ryr2	UTSW	13	11,760,487 (GRCm39)	missense	probably damaging	0.98
R5518:Ryr2	UTSW	13	11,702,795 (GRCm39)	missense	probably benign	0.01
R5571:Ryr2	UTSW	13	11,570,334 (GRCm39)	missense	possibly damaging	0.91
R5591:Ryr2	UTSW	13	11,609,900 (GRCm39)	missense	probably benign	0.06
R5619:Ryr2	UTSW	13	11,723,088 (GRCm39)	missense	probably damaging	1.00
R5630:Ryr2	UTSW	13	11,616,691 (GRCm39)	missense	probably damaging	1.00
R5644:Ryr2	UTSW	13	11,610,468 (GRCm39)	missense	probably damaging	0.99
R5667:Ryr2	UTSW	13	11,774,722 (GRCm39)	missense	probably damaging	1.00
R5775:Ryr2	UTSW	13	11,784,848 (GRCm39)	missense	probably damaging	1.00
R5836:Ryr2	UTSW	13	11,618,618 (GRCm39)	missense	probably damaging	1.00
R5858:Ryr2	UTSW	13	11,575,460 (GRCm39)	missense	probably damaging	0.99
R5934:Ryr2	UTSW	13	11,599,040 (GRCm39)	missense	probably damaging	0.96
R5939:Ryr2	UTSW	13	11,805,218 (GRCm39)	missense	probably damaging	0.99
R5941:Ryr2	UTSW	13	11,702,788 (GRCm39)	missense	probably damaging	1.00
R5945:Ryr2	UTSW	13	11,675,008 (GRCm39)	missense	probably damaging	1.00
R5946:Ryr2	UTSW	13	11,741,839 (GRCm39)	missense	probably damaging	1.00
R5966:Ryr2	UTSW	13	11,677,124 (GRCm39)	nonsense	probably null
R5974:Ryr2	UTSW	13	11,729,397 (GRCm39)	splice site	probably null
R6104:Ryr2	UTSW	13	11,814,711 (GRCm39)	missense	probably damaging	1.00
R6118:Ryr2	UTSW	13	11,807,575 (GRCm39)	missense	possibly damaging	0.69
R6149:Ryr2	UTSW	13	11,683,903 (GRCm39)	missense	probably benign
R6208:Ryr2	UTSW	13	11,910,106 (GRCm39)	missense	probably benign	0.04
R6217:Ryr2	UTSW	13	11,848,964 (GRCm39)	missense	probably damaging	1.00
R6230:Ryr2	UTSW	13	11,674,993 (GRCm39)	missense	probably damaging	0.99
R6279:Ryr2	UTSW	13	11,695,885 (GRCm39)	missense	probably damaging	0.97
R6294:Ryr2	UTSW	13	11,894,382 (GRCm39)	missense	probably damaging	1.00
R6300:Ryr2	UTSW	13	11,695,885 (GRCm39)	missense	probably damaging	0.97
R6350:Ryr2	UTSW	13	11,776,282 (GRCm39)	missense	probably damaging	0.98
R6484:Ryr2	UTSW	13	11,677,269 (GRCm39)	missense	possibly damaging	0.90
R6489:Ryr2	UTSW	13	11,848,893 (GRCm39)	missense	probably benign	0.29
R6548:Ryr2	UTSW	13	11,683,707 (GRCm39)	missense	probably damaging	1.00
R6591:Ryr2	UTSW	13	11,609,609 (GRCm39)	missense	probably benign	0.01
R6623:Ryr2	UTSW	13	11,724,951 (GRCm39)	missense	probably damaging	1.00
R6649:Ryr2	UTSW	13	11,610,529 (GRCm39)	missense	probably damaging	0.99
R6691:Ryr2	UTSW	13	11,609,609 (GRCm39)	missense	probably benign	0.01
R6770:Ryr2	UTSW	13	11,753,348 (GRCm39)	missense	probably damaging	1.00
R6802:Ryr2	UTSW	13	11,701,852 (GRCm39)	missense	probably damaging	1.00
R6809:Ryr2	UTSW	13	11,741,816 (GRCm39)	missense	probably damaging	1.00
R6893:Ryr2	UTSW	13	11,844,540 (GRCm39)	missense	possibly damaging	0.75
R6911:Ryr2	UTSW	13	11,842,445 (GRCm39)	missense	possibly damaging	0.50
R6915:Ryr2	UTSW	13	11,760,487 (GRCm39)	missense	probably damaging	1.00
R6943:Ryr2	UTSW	13	11,581,834 (GRCm39)	missense	possibly damaging	0.92
R6960:Ryr2	UTSW	13	11,816,129 (GRCm39)	missense	probably benign	0.28
R6997:Ryr2	UTSW	13	11,669,266 (GRCm39)	missense	possibly damaging	0.88
R6998:Ryr2	UTSW	13	11,727,052 (GRCm39)	missense	probably damaging	0.99
R7001:Ryr2	UTSW	13	11,809,491 (GRCm39)	missense	probably damaging	0.98
R7047:Ryr2	UTSW	13	11,839,286 (GRCm39)	missense	possibly damaging	0.64
R7089:Ryr2	UTSW	13	11,664,662 (GRCm39)	missense	probably benign	0.10
R7125:Ryr2	UTSW	13	11,684,873 (GRCm39)	missense	probably damaging	0.99
R7127:Ryr2	UTSW	13	11,670,599 (GRCm39)	missense	probably damaging	1.00
R7131:Ryr2	UTSW	13	11,683,697 (GRCm39)	critical splice donor site	probably null
R7131:Ryr2	UTSW	13	11,655,213 (GRCm39)	missense	possibly damaging	0.63
R7159:Ryr2	UTSW	13	11,825,794 (GRCm39)	missense	probably damaging	0.99
R7174:Ryr2	UTSW	13	11,816,063 (GRCm39)	missense	possibly damaging	0.81
R7180:Ryr2	UTSW	13	11,701,864 (GRCm39)	missense	probably damaging	1.00
R7182:Ryr2	UTSW	13	11,774,643 (GRCm39)	missense	probably benign
R7189:Ryr2	UTSW	13	11,898,009 (GRCm39)	missense	probably damaging	1.00
R7244:Ryr2	UTSW	13	11,612,032 (GRCm39)	missense	probably damaging	1.00
R7326:Ryr2	UTSW	13	11,753,080 (GRCm39)	missense	possibly damaging	0.95
R7331:Ryr2	UTSW	13	11,760,517 (GRCm39)	missense	probably benign
R7365:Ryr2	UTSW	13	11,655,161 (GRCm39)	missense	probably damaging	0.99
R7372:Ryr2	UTSW	13	11,695,885 (GRCm39)	missense	probably damaging	0.97
R7395:Ryr2	UTSW	13	11,799,997 (GRCm39)	missense	probably damaging	0.98
R7404:Ryr2	UTSW	13	11,750,506 (GRCm39)	missense	probably damaging	0.97
R7417:Ryr2	UTSW	13	11,571,634 (GRCm39)	splice site	probably null
R7425:Ryr2	UTSW	13	11,720,530 (GRCm39)	missense	probably benign	0.20
R7444:Ryr2	UTSW	13	11,570,349 (GRCm39)	missense	probably benign	0.25
R7456:Ryr2	UTSW	13	11,767,168 (GRCm39)	missense	probably benign
R7460:Ryr2	UTSW	13	11,720,596 (GRCm39)	missense	probably benign	0.10
R7474:Ryr2	UTSW	13	11,609,762 (GRCm39)	missense	probably benign	0.04
R7543:Ryr2	UTSW	13	11,653,317 (GRCm39)	critical splice donor site	probably null
R7549:Ryr2	UTSW	13	11,752,871 (GRCm39)	missense	probably benign	0.15
R7558:Ryr2	UTSW	13	11,814,711 (GRCm39)	missense	probably damaging	1.00
R7565:Ryr2	UTSW	13	11,575,539 (GRCm39)	missense	possibly damaging	0.84
R7627:Ryr2	UTSW	13	11,776,213 (GRCm39)	missense	possibly damaging	0.65
R7698:Ryr2	UTSW	13	11,776,201 (GRCm39)	missense	possibly damaging	0.94
R7702:Ryr2	UTSW	13	11,705,219 (GRCm39)	missense	probably damaging	0.99
R7719:Ryr2	UTSW	13	11,745,229 (GRCm39)	missense	possibly damaging	0.94
R7772:Ryr2	UTSW	13	11,765,897 (GRCm39)	missense	probably benign
R7797:Ryr2	UTSW	13	11,816,066 (GRCm39)	missense	probably damaging	0.99
R7829:Ryr2	UTSW	13	11,842,493 (GRCm39)	missense	possibly damaging	0.81
R7855:Ryr2	UTSW	13	11,721,509 (GRCm39)	nonsense	probably null
R7872:Ryr2	UTSW	13	11,610,610 (GRCm39)	missense	probably damaging	1.00
R7908:Ryr2	UTSW	13	11,807,634 (GRCm39)	missense	probably benign	0.01
R7929:Ryr2	UTSW	13	11,609,680 (GRCm39)	missense	probably damaging	1.00
R7929:Ryr2	UTSW	13	11,705,181 (GRCm39)	nonsense	probably null
R7952:Ryr2	UTSW	13	11,661,313 (GRCm39)	splice site	probably null
R8008:Ryr2	UTSW	13	11,671,980 (GRCm39)	missense	probably benign	0.30
R8011:Ryr2	UTSW	13	11,603,026 (GRCm39)	critical splice donor site	probably null
R8097:Ryr2	UTSW	13	11,960,881 (GRCm39)	missense	probably damaging	0.98
R8133:Ryr2	UTSW	13	11,618,584 (GRCm39)	missense	probably damaging	1.00
R8253:Ryr2	UTSW	13	11,842,439 (GRCm39)	missense	possibly damaging	0.94
R8278:Ryr2	UTSW	13	11,610,392 (GRCm39)	nonsense	probably null
R8351:Ryr2	UTSW	13	11,814,718 (GRCm39)	missense	probably damaging	0.98
R8401:Ryr2	UTSW	13	11,683,821 (GRCm39)	missense	possibly damaging	0.95
R8403:Ryr2	UTSW	13	11,699,364 (GRCm39)	missense	possibly damaging	0.95
R8431:Ryr2	UTSW	13	11,673,894 (GRCm39)	missense	probably benign	0.00
R8509:Ryr2	UTSW	13	11,592,664 (GRCm39)	critical splice donor site	probably null
R8551:Ryr2	UTSW	13	11,575,479 (GRCm39)	missense	possibly damaging	0.93
R8684:Ryr2	UTSW	13	11,702,875 (GRCm39)	missense	probably damaging	0.99
R8735:Ryr2	UTSW	13	11,701,833 (GRCm39)	missense	probably damaging	0.97
R8766:Ryr2	UTSW	13	11,683,855 (GRCm39)	missense	probably damaging	0.97
R8817:Ryr2	UTSW	13	11,750,509 (GRCm39)	missense	possibly damaging	0.95
R8827:Ryr2	UTSW	13	11,572,934 (GRCm39)	missense	possibly damaging	0.80
R8884:Ryr2	UTSW	13	11,794,152 (GRCm39)	missense	probably benign	0.19
R8889:Ryr2	UTSW	13	11,799,990 (GRCm39)	missense	probably damaging	0.99
R8891:Ryr2	UTSW	13	11,814,768 (GRCm39)	missense	probably damaging	1.00
R8979:Ryr2	UTSW	13	11,609,924 (GRCm39)	missense	probably benign	0.00
R9013:Ryr2	UTSW	13	11,618,618 (GRCm39)	missense	probably damaging	0.98
R9040:Ryr2	UTSW	13	11,609,672 (GRCm39)	missense	probably damaging	0.97
R9044:Ryr2	UTSW	13	11,752,989 (GRCm39)	nonsense	probably null
R9056:Ryr2	UTSW	13	11,610,817 (GRCm39)	missense	possibly damaging	0.94
R9084:Ryr2	UTSW	13	11,616,724 (GRCm39)	missense	probably damaging	1.00
R9113:Ryr2	UTSW	13	11,618,741 (GRCm39)	intron	probably benign
R9116:Ryr2	UTSW	13	11,587,185 (GRCm39)	missense	possibly damaging	0.93
R9125:Ryr2	UTSW	13	11,669,292 (GRCm39)	missense	probably benign	0.28
R9148:Ryr2	UTSW	13	11,900,424 (GRCm39)	missense	probably benign	0.02
R9210:Ryr2	UTSW	13	11,844,560 (GRCm39)	missense	probably damaging	0.99
R9212:Ryr2	UTSW	13	11,844,560 (GRCm39)	missense	probably damaging	0.99
R9233:Ryr2	UTSW	13	11,610,772 (GRCm39)	missense	possibly damaging	0.77
R9254:Ryr2	UTSW	13	11,898,002 (GRCm39)	missense	probably damaging	1.00
R9262:Ryr2	UTSW	13	11,765,854 (GRCm39)	missense	probably damaging	0.97
R9275:Ryr2	UTSW	13	11,897,976 (GRCm39)	missense	probably benign	0.10
R9278:Ryr2	UTSW	13	11,897,976 (GRCm39)	missense	probably benign	0.10
R9309:Ryr2	UTSW	13	11,721,578 (GRCm39)	missense	probably damaging	0.99
R9379:Ryr2	UTSW	13	11,898,002 (GRCm39)	missense	probably damaging	1.00
R9409:Ryr2	UTSW	13	11,695,973 (GRCm39)	missense	probably damaging	0.99
R9429:Ryr2	UTSW	13	11,809,459 (GRCm39)	missense	probably damaging	0.97
R9445:Ryr2	UTSW	13	11,787,463 (GRCm39)	missense	probably damaging	1.00
R9464:Ryr2	UTSW	13	11,752,680 (GRCm39)	missense	probably benign	0.00
R9467:Ryr2	UTSW	13	11,571,490 (GRCm39)	missense	possibly damaging	0.70
R9546:Ryr2	UTSW	13	11,602,101 (GRCm39)	critical splice donor site	probably null
R9562:Ryr2	UTSW	13	11,760,104 (GRCm39)	missense	probably damaging	1.00
R9609:Ryr2	UTSW	13	11,683,848 (GRCm39)	missense	probably damaging	1.00
R9704:Ryr2	UTSW	13	11,737,646 (GRCm39)	missense	probably damaging	1.00
R9764:Ryr2	UTSW	13	11,701,935 (GRCm39)	missense	possibly damaging	0.67
R9772:Ryr2	UTSW	13	11,609,785 (GRCm39)	missense	probably benign	0.13
R9776:Ryr2	UTSW	13	11,707,599 (GRCm39)	missense	probably damaging	0.98
S24628:Ryr2	UTSW	13	11,884,042 (GRCm39)	missense	probably damaging	0.97
X0019:Ryr2	UTSW	13	11,718,387 (GRCm39)	missense	probably benign	0.04
Z1176:Ryr2	UTSW	13	11,658,689 (GRCm39)	critical splice donor site	probably null
Z1176:Ryr2	UTSW	13	11,613,497 (GRCm39)	critical splice acceptor site	probably null
Z1176:Ryr2	UTSW	13	11,809,435 (GRCm39)	nonsense	probably null
Z1177:Ryr2	UTSW	13	11,765,759 (GRCm39)	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- GCCCACTGTTCCCTTACAAG -3'
(R):5'- TGTTTTAACTCAGGGGAGGTAGAAG -3'

Sequencing Primer
(F):5'- TTCCCTTACAAGTACTTCCAGAAATC -3'
(R):5'- ATTGGTATCTCTCTTGCCTGTTAAAC -3'

Posted On

2019-06-26