Incidental Mutation 'R7241:Unc5a'
ID563231
Institutional Source Beutler Lab
Gene Symbol Unc5a
Ensembl Gene ENSMUSG00000025876
Gene Nameunc-5 netrin receptor A
SynonymsUnc5h1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7241 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location54949411-55006018 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 54991020 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 71 (T71S)
Ref Sequence ENSEMBL: ENSMUSP00000026994 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026994] [ENSMUST00000109994]
Predicted Effect probably damaging
Transcript: ENSMUST00000026994
AA Change: T71S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026994
Gene: ENSMUSG00000025876
AA Change: T71S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
SCOP:d1biha1 44 143 1e-4 SMART
IG 155 240 1.8e-5 SMART
TSP1 245 296 1.25e-14 SMART
TSP1 301 350 1.98e-8 SMART
transmembrane domain 360 382 N/A INTRINSIC
ZU5 495 598 3.68e-58 SMART
DEATH 805 896 5.86e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109994
AA Change: T71S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105621
Gene: ENSMUSG00000025876
AA Change: T71S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
SCOP:d1biha1 44 143 1e-4 SMART
IG 155 240 1.8e-5 SMART
TSP1 245 294 1.98e-8 SMART
transmembrane domain 305 327 N/A INTRINSIC
ZU5 439 542 3.68e-58 SMART
DEATH 749 840 5.86e-20 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UNC5A belongs to a family of netrin-1 (MIM 601614) receptors thought to mediate the chemorepulsive effect of netrin-1 on specific axons. For more information on UNC5 proteins, see UNC5C (MIM 603610).[supplied by OMIM, Apr 2004]
PHENOTYPE: Homozygous null mice are viable through adulthood but display decreased apoptotic cell death, supernumerary neurons and morphological alterations in the embryonic cervical spinal cord. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,287,042 E3378G probably benign Het
Abca14 A G 7: 120,246,961 T612A probably damaging Het
Acacb G A 5: 114,245,100 A2115T possibly damaging Het
Adam32 T C 8: 24,898,494 K398R probably benign Het
Adam9 T A 8: 24,950,986 I824F possibly damaging Het
Ahnak A G 19: 9,009,031 I2560V possibly damaging Het
Ank3 G A 10: 69,706,814 M1I probably null Het
Anks1b T G 10: 90,512,837 I789S probably damaging Het
Ap2b1 T A 11: 83,351,105 N641K probably benign Het
Arhgap33 A G 7: 30,528,721 L412P probably damaging Het
Atp13a3 T A 16: 30,352,277 M317L possibly damaging Het
B4galt5 A G 2: 167,306,697 L167P probably damaging Het
Bace2 T C 16: 97,436,798 I483T possibly damaging Het
C2cd3 A C 7: 100,407,050 K177T Het
Ccr4 T C 9: 114,492,956 T14A probably benign Het
Cep250 A T 2: 155,991,552 H1799L probably benign Het
Cgnl1 T C 9: 71,724,770 Q433R probably benign Het
Copb1 C T 7: 114,237,356 V384M probably damaging Het
Cyp2c50 T A 19: 40,090,568 N118K probably benign Het
Cyp4a32 A G 4: 115,602,302 I78V probably benign Het
Cyth4 A G 15: 78,607,045 K108R probably benign Het
Dnah1 T C 14: 31,264,939 H3632R probably benign Het
Dnah3 T C 7: 119,943,633 I540V probably benign Het
Dock4 A G 12: 40,794,860 Y1174C probably damaging Het
Drd5 A G 5: 38,320,536 T291A probably damaging Het
Fam102a A G 2: 32,558,064 R62G probably benign Het
Fbn1 T C 2: 125,306,495 N2611S possibly damaging Het
Fhod3 A G 18: 25,060,352 E640G probably damaging Het
Flvcr2 T A 12: 85,805,239 D522E probably benign Het
Fuk A G 8: 110,895,897 I133T probably benign Het
Ganc T A 2: 120,441,529 I556K probably damaging Het
Gjc2 T A 11: 59,177,134 E174V unknown Het
Gm4869 A G 5: 140,462,188 T137A probably damaging Het
Gzmd G A 14: 56,131,342 R32C probably damaging Het
Hltf T A 3: 20,065,392 H200Q probably benign Het
Hrasls5 A G 19: 7,614,581 T121A probably benign Het
Ift88 A G 14: 57,479,997 I559M probably damaging Het
Ighv1-62-1 C A 12: 115,386,702 C115F probably damaging Het
Impdh2 A G 9: 108,563,437 N279S possibly damaging Het
Itpr1 T C 6: 108,517,620 probably null Het
Kansl1l T C 1: 66,801,628 N171S possibly damaging Het
Kif14 T A 1: 136,468,753 C266S probably benign Het
Lrriq1 A C 10: 103,215,973 V306G probably damaging Het
Mast4 G A 13: 103,334,000 R65W possibly damaging Het
Mex3d T C 10: 80,387,257 D55G Het
Mrps27 A T 13: 99,411,280 K233* probably null Het
Myo1f A G 17: 33,579,928 N189S probably damaging Het
Nbn A T 4: 15,991,190 K729N probably benign Het
Olfr1082 C A 2: 86,594,154 V225F possibly damaging Het
Olfr395 T C 11: 73,907,232 S87G probably benign Het
Park2 C A 17: 11,854,861 N355K possibly damaging Het
Pgghg T C 7: 140,945,720 S479P Het
Polr1e A C 4: 45,029,340 H315P probably damaging Het
Pou6f2 A G 13: 18,125,289 V595A Het
Prdm15 T C 16: 97,795,741 D960G possibly damaging Het
Prkcz A T 4: 155,269,059 M460K probably benign Het
Prkd2 G T 7: 16,857,805 R587L probably benign Het
Rabep1 C A 11: 70,939,989 T829N probably damaging Het
Rptn A G 3: 93,395,954 E198G probably benign Het
Ryr2 A T 13: 11,665,913 I3182N possibly damaging Het
Sectm1a T A 11: 121,069,882 I36F possibly damaging Het
Sez6l T C 5: 112,473,480 S243G probably benign Het
Taf2 T A 15: 55,062,141 H235L probably benign Het
Tbc1d7 T C 13: 43,153,017 Q161R probably benign Het
Tfcp2 T C 15: 100,518,587 T271A possibly damaging Het
Thrsp G T 7: 97,417,088 T139K probably damaging Het
Timm10 T A 2: 84,829,989 *91R probably null Het
Tlr11 T A 14: 50,362,141 I528N possibly damaging Het
Tnnt2 T A 1: 135,851,706 L278Q probably damaging Het
Toe1 A T 4: 116,807,518 M1K probably null Het
Trpv5 G A 6: 41,675,308 R148* probably null Het
Ttll13 A C 7: 80,254,163 K280Q probably damaging Het
Ttn A G 2: 76,953,206 V860A unknown Het
Txnip T C 3: 96,559,675 Y222H probably damaging Het
Ubr4 G A 4: 139,443,414 S1600N probably damaging Het
Uhrf1 T C 17: 56,315,193 Y364H probably damaging Het
Vmn1r123 A T 7: 21,162,612 Y143F possibly damaging Het
Vmn1r180 T A 7: 23,952,466 I18N probably damaging Het
Washc2 A G 6: 116,208,207 M1V probably null Het
Zfp174 C A 16: 3,848,247 H125Q probably benign Het
Zfpl1 T C 19: 6,081,913 H227R possibly damaging Het
Other mutations in Unc5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Unc5a APN 13 54995820 missense probably benign 0.00
IGL00339:Unc5a APN 13 54995815 missense possibly damaging 0.89
IGL00924:Unc5a APN 13 55004514 missense probably damaging 0.99
IGL01411:Unc5a APN 13 55002928 missense probably damaging 1.00
IGL01511:Unc5a APN 13 55004816 missense probably damaging 0.97
IGL02430:Unc5a APN 13 55002482 missense probably damaging 1.00
IGL02996:Unc5a APN 13 54996178 missense probably damaging 0.99
IGL03188:Unc5a APN 13 54999503 missense probably damaging 0.98
PIT1430001:Unc5a UTSW 13 55003896 missense probably damaging 1.00
PIT4378001:Unc5a UTSW 13 54995868 missense possibly damaging 0.95
R0009:Unc5a UTSW 13 55002879 missense probably damaging 1.00
R0009:Unc5a UTSW 13 55002879 missense probably damaging 1.00
R0028:Unc5a UTSW 13 55003913 missense possibly damaging 0.70
R0505:Unc5a UTSW 13 55004954 missense probably damaging 1.00
R0744:Unc5a UTSW 13 55003933 missense possibly damaging 0.92
R0745:Unc5a UTSW 13 55005255 frame shift probably null
R0836:Unc5a UTSW 13 55003933 missense possibly damaging 0.92
R1018:Unc5a UTSW 13 54990952 missense possibly damaging 0.81
R1432:Unc5a UTSW 13 55004472 unclassified probably benign
R1469:Unc5a UTSW 13 54996419 missense probably damaging 1.00
R1469:Unc5a UTSW 13 54996419 missense probably damaging 1.00
R1691:Unc5a UTSW 13 55002924 missense probably damaging 1.00
R2132:Unc5a UTSW 13 54991083 missense probably damaging 0.96
R4020:Unc5a UTSW 13 55003369 missense probably damaging 1.00
R4080:Unc5a UTSW 13 55004481 missense possibly damaging 0.62
R4720:Unc5a UTSW 13 55003883 missense probably null 1.00
R4876:Unc5a UTSW 13 54997229 missense probably benign
R4953:Unc5a UTSW 13 54999870 missense probably benign 0.02
R5112:Unc5a UTSW 13 55003418 critical splice donor site probably null
R5593:Unc5a UTSW 13 55004934 missense possibly damaging 0.91
R5903:Unc5a UTSW 13 54999690 missense possibly damaging 0.92
R6521:Unc5a UTSW 13 55004935 missense probably benign 0.01
R6723:Unc5a UTSW 13 54995889 missense probably benign 0.23
R7038:Unc5a UTSW 13 55004484 missense probably damaging 1.00
R7065:Unc5a UTSW 13 54991083 missense probably damaging 1.00
R7365:Unc5a UTSW 13 54996573 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GGGAAGATCTGGCTCACATC -3'
(R):5'- ATATTCATAGGGTGCCAGGTG -3'

Sequencing Primer
(F):5'- GAAGATCTGGCTCACATCTCCCC -3'
(R):5'- CTTGCCTGGTGATACCGAAG -3'
Posted On2019-06-26