Incidental Mutation 'R7241:Ift88'
ID563237
Institutional Source Beutler Lab
Gene Symbol Ift88
Ensembl Gene ENSMUSG00000040040
Gene Nameintraflagellar transport 88
SynonymsTg737Rpw, IFT88, Tg737, polaris, Oak Ridge polycystic kidneys, TgN737Rpw, orpk, fxo, Ttc10
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7241 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location57424062-57517936 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 57479997 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 559 (I559M)
Ref Sequence ENSEMBL: ENSMUSP00000113768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122063]
Predicted Effect probably damaging
Transcript: ENSMUST00000122063
AA Change: I559M

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113768
Gene: ENSMUSG00000040040
AA Change: I559M

DomainStartEndE-ValueType
Blast:TPR 197 229 8e-12 BLAST
TPR 233 266 5.35e-5 SMART
TPR 272 305 5.78e-1 SMART
TPR 485 518 5.73e-5 SMART
TPR 519 552 9.83e-4 SMART
TPR 553 586 5.19e-3 SMART
TPR 587 620 3.87e-2 SMART
Blast:TPR 621 654 7e-12 BLAST
TPR 655 688 3.76e0 SMART
low complexity region 730 748 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171682
SMART Domains Protein: ENSMUSP00000130475
Gene: ENSMUSG00000040040

DomainStartEndE-ValueType
Pfam:DUF3808 1 164 2.7e-8 PFAM
Pfam:TPR_11 3 76 8.7e-11 PFAM
Pfam:TPR_12 3 77 3.8e-11 PFAM
Pfam:TPR_8 6 37 7e-4 PFAM
Pfam:TPR_2 7 38 1.8e-6 PFAM
Pfam:TPR_1 7 39 3.4e-9 PFAM
Pfam:TPR_7 8 41 1.9e-7 PFAM
Pfam:TPR_8 45 78 2.2e-3 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tetratrico peptide repeat (TPR) family. Mutations of a similar gene in mouse can cause polycystic kidney disease. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display early to mid-gestation lethality, random patterning of the left-right body axis, neural tube defects, pericardial sac expansion, enlarged limb buds, polydactyly, and absent embryonic node cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,287,042 E3378G probably benign Het
Abca14 A G 7: 120,246,961 T612A probably damaging Het
Acacb G A 5: 114,245,100 A2115T possibly damaging Het
Adam32 T C 8: 24,898,494 K398R probably benign Het
Adam9 T A 8: 24,950,986 I824F possibly damaging Het
Ahnak A G 19: 9,009,031 I2560V possibly damaging Het
Ank3 G A 10: 69,706,814 M1I probably null Het
Anks1b T G 10: 90,512,837 I789S probably damaging Het
Ap2b1 T A 11: 83,351,105 N641K probably benign Het
Arhgap33 A G 7: 30,528,721 L412P probably damaging Het
Atp13a3 T A 16: 30,352,277 M317L possibly damaging Het
B4galt5 A G 2: 167,306,697 L167P probably damaging Het
Bace2 T C 16: 97,436,798 I483T possibly damaging Het
C2cd3 A C 7: 100,407,050 K177T Het
Ccr4 T C 9: 114,492,956 T14A probably benign Het
Cep250 A T 2: 155,991,552 H1799L probably benign Het
Cgnl1 T C 9: 71,724,770 Q433R probably benign Het
Copb1 C T 7: 114,237,356 V384M probably damaging Het
Cyp2c50 T A 19: 40,090,568 N118K probably benign Het
Cyp4a32 A G 4: 115,602,302 I78V probably benign Het
Cyth4 A G 15: 78,607,045 K108R probably benign Het
Dnah1 T C 14: 31,264,939 H3632R probably benign Het
Dnah3 T C 7: 119,943,633 I540V probably benign Het
Dock4 A G 12: 40,794,860 Y1174C probably damaging Het
Drd5 A G 5: 38,320,536 T291A probably damaging Het
Fam102a A G 2: 32,558,064 R62G probably benign Het
Fbn1 T C 2: 125,306,495 N2611S possibly damaging Het
Fhod3 A G 18: 25,060,352 E640G probably damaging Het
Flvcr2 T A 12: 85,805,239 D522E probably benign Het
Fuk A G 8: 110,895,897 I133T probably benign Het
Ganc T A 2: 120,441,529 I556K probably damaging Het
Gjc2 T A 11: 59,177,134 E174V unknown Het
Gm4869 A G 5: 140,462,188 T137A probably damaging Het
Gzmd G A 14: 56,131,342 R32C probably damaging Het
Hltf T A 3: 20,065,392 H200Q probably benign Het
Hrasls5 A G 19: 7,614,581 T121A probably benign Het
Ighv1-62-1 C A 12: 115,386,702 C115F probably damaging Het
Impdh2 A G 9: 108,563,437 N279S possibly damaging Het
Itpr1 T C 6: 108,517,620 probably null Het
Kansl1l T C 1: 66,801,628 N171S possibly damaging Het
Kif14 T A 1: 136,468,753 C266S probably benign Het
Lrriq1 A C 10: 103,215,973 V306G probably damaging Het
Mast4 G A 13: 103,334,000 R65W possibly damaging Het
Mex3d T C 10: 80,387,257 D55G Het
Mrps27 A T 13: 99,411,280 K233* probably null Het
Myo1f A G 17: 33,579,928 N189S probably damaging Het
Nbn A T 4: 15,991,190 K729N probably benign Het
Olfr1082 C A 2: 86,594,154 V225F possibly damaging Het
Olfr395 T C 11: 73,907,232 S87G probably benign Het
Park2 C A 17: 11,854,861 N355K possibly damaging Het
Pgghg T C 7: 140,945,720 S479P Het
Polr1e A C 4: 45,029,340 H315P probably damaging Het
Pou6f2 A G 13: 18,125,289 V595A Het
Prdm15 T C 16: 97,795,741 D960G possibly damaging Het
Prkcz A T 4: 155,269,059 M460K probably benign Het
Prkd2 G T 7: 16,857,805 R587L probably benign Het
Rabep1 C A 11: 70,939,989 T829N probably damaging Het
Rptn A G 3: 93,395,954 E198G probably benign Het
Ryr2 A T 13: 11,665,913 I3182N possibly damaging Het
Sectm1a T A 11: 121,069,882 I36F possibly damaging Het
Sez6l T C 5: 112,473,480 S243G probably benign Het
Taf2 T A 15: 55,062,141 H235L probably benign Het
Tbc1d7 T C 13: 43,153,017 Q161R probably benign Het
Tfcp2 T C 15: 100,518,587 T271A possibly damaging Het
Thrsp G T 7: 97,417,088 T139K probably damaging Het
Timm10 T A 2: 84,829,989 *91R probably null Het
Tlr11 T A 14: 50,362,141 I528N possibly damaging Het
Tnnt2 T A 1: 135,851,706 L278Q probably damaging Het
Toe1 A T 4: 116,807,518 M1K probably null Het
Trpv5 G A 6: 41,675,308 R148* probably null Het
Ttll13 A C 7: 80,254,163 K280Q probably damaging Het
Ttn A G 2: 76,953,206 V860A unknown Het
Txnip T C 3: 96,559,675 Y222H probably damaging Het
Ubr4 G A 4: 139,443,414 S1600N probably damaging Het
Uhrf1 T C 17: 56,315,193 Y364H probably damaging Het
Unc5a A T 13: 54,991,020 T71S probably damaging Het
Vmn1r123 A T 7: 21,162,612 Y143F possibly damaging Het
Vmn1r180 T A 7: 23,952,466 I18N probably damaging Het
Washc2 A G 6: 116,208,207 M1V probably null Het
Zfp174 C A 16: 3,848,247 H125Q probably benign Het
Zfpl1 T C 19: 6,081,913 H227R possibly damaging Het
Other mutations in Ift88
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Ift88 APN 14 57481386 unclassified probably benign
IGL00886:Ift88 APN 14 57478068 missense probably damaging 1.00
IGL00901:Ift88 APN 14 57444445 missense probably damaging 0.99
IGL01148:Ift88 APN 14 57439732 missense probably benign 0.19
IGL01346:Ift88 APN 14 57444405 missense probably damaging 1.00
IGL01474:Ift88 APN 14 57478074 missense probably benign 0.23
IGL02213:Ift88 APN 14 57478045 missense probably damaging 1.00
IGL02391:Ift88 APN 14 57481414 missense possibly damaging 0.64
IGL03087:Ift88 APN 14 57477957 missense probably benign 0.00
R0392:Ift88 UTSW 14 57496160 splice site probably benign
R0608:Ift88 UTSW 14 57496221 missense probably benign
R0718:Ift88 UTSW 14 57517413 missense probably benign 0.02
R1128:Ift88 UTSW 14 57517019 nonsense probably null
R1422:Ift88 UTSW 14 57438301 splice site probably benign
R1422:Ift88 UTSW 14 57472979 missense probably damaging 1.00
R1432:Ift88 UTSW 14 57437279 missense probably benign
R1518:Ift88 UTSW 14 57430628 missense possibly damaging 0.64
R1566:Ift88 UTSW 14 57441011 missense probably benign 0.36
R1819:Ift88 UTSW 14 57455519 missense probably damaging 1.00
R2239:Ift88 UTSW 14 57455504 missense probably damaging 1.00
R2273:Ift88 UTSW 14 57488936 missense possibly damaging 0.90
R2926:Ift88 UTSW 14 57488918 missense probably damaging 1.00
R3033:Ift88 UTSW 14 57478044 missense probably damaging 1.00
R3052:Ift88 UTSW 14 57430568 missense probably damaging 1.00
R3815:Ift88 UTSW 14 57440981 missense possibly damaging 0.88
R4411:Ift88 UTSW 14 57477979 missense probably damaging 0.99
R4703:Ift88 UTSW 14 57480850 unclassified probably benign
R4704:Ift88 UTSW 14 57480850 unclassified probably benign
R4822:Ift88 UTSW 14 57441869 splice site probably null
R5355:Ift88 UTSW 14 57438242 missense probably benign 0.34
R5618:Ift88 UTSW 14 57481508 missense possibly damaging 0.72
R6602:Ift88 UTSW 14 57507259 missense probably benign 0.00
R6907:Ift88 UTSW 14 57445610 missense probably benign 0.23
R7243:Ift88 UTSW 14 57430536 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGCTAGGAGAAATCTCACCTCC -3'
(R):5'- TCCTACAGGAGTCAGAGTTAATACG -3'

Sequencing Primer
(F):5'- GGAGAAATCTCACCTCCTCTTG -3'
(R):5'- CAGAGCTATGTTTACTCAAAATGTCC -3'
Posted On2019-06-26