Incidental Mutation 'R7241:Cyth4'
ID563239
Institutional Source Beutler Lab
Gene Symbol Cyth4
Ensembl Gene ENSMUSG00000018008
Gene Namecytohesin 4
Synonyms5830469K17Rik, 2510004M07Rik, Pscd4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R7241 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location78597047-78622019 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78607045 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 108 (K108R)
Ref Sequence ENSEMBL: ENSMUSP00000042698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043069] [ENSMUST00000229248] [ENSMUST00000229256] [ENSMUST00000229295] [ENSMUST00000229717] [ENSMUST00000229796] [ENSMUST00000231168] [ENSMUST00000231180]
Predicted Effect probably benign
Transcript: ENSMUST00000043069
AA Change: K108R

PolyPhen 2 Score 0.381 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000042698
Gene: ENSMUSG00000018008
AA Change: K108R

DomainStartEndE-ValueType
Sec7 58 243 1.05e-90 SMART
PH 260 377 2.11e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229248
Predicted Effect probably benign
Transcript: ENSMUST00000229256
Predicted Effect probably benign
Transcript: ENSMUST00000229295
Predicted Effect probably benign
Transcript: ENSMUST00000229717
Predicted Effect probably benign
Transcript: ENSMUST00000229796
Predicted Effect probably benign
Transcript: ENSMUST00000231168
AA Change: K108R

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000231180
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PSCD family of proteins, which have an N-terminal coiled-coil motif, a central Sec7 domain, and a C-terminal pleckstrin homology (PH) domain. The coiled-coil motif is involved in homodimerization, the Sec7 domain contains guanine-nucleotide exchange protein (GEP) activity, and the PH domain interacts with phospholipids and is responsible for association of PSCDs with membranes. Members of this family function as GEPs for ADP-ribosylation factors (ARFs), which are guanine nucleotide-binding proteins involved in vesicular trafficking pathways. This protein exhibits GEP activity in vitro with ARF1 and ARF5, but is inactive with ARF6. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,287,042 E3378G probably benign Het
Abca14 A G 7: 120,246,961 T612A probably damaging Het
Acacb G A 5: 114,245,100 A2115T possibly damaging Het
Adam32 T C 8: 24,898,494 K398R probably benign Het
Adam9 T A 8: 24,950,986 I824F possibly damaging Het
Ahnak A G 19: 9,009,031 I2560V possibly damaging Het
Ank3 G A 10: 69,706,814 M1I probably null Het
Anks1b T G 10: 90,512,837 I789S probably damaging Het
Ap2b1 T A 11: 83,351,105 N641K probably benign Het
Arhgap33 A G 7: 30,528,721 L412P probably damaging Het
Atp13a3 T A 16: 30,352,277 M317L possibly damaging Het
B4galt5 A G 2: 167,306,697 L167P probably damaging Het
Bace2 T C 16: 97,436,798 I483T possibly damaging Het
C2cd3 A C 7: 100,407,050 K177T Het
Ccr4 T C 9: 114,492,956 T14A probably benign Het
Cep250 A T 2: 155,991,552 H1799L probably benign Het
Cgnl1 T C 9: 71,724,770 Q433R probably benign Het
Copb1 C T 7: 114,237,356 V384M probably damaging Het
Cyp2c50 T A 19: 40,090,568 N118K probably benign Het
Cyp4a32 A G 4: 115,602,302 I78V probably benign Het
Dnah1 T C 14: 31,264,939 H3632R probably benign Het
Dnah3 T C 7: 119,943,633 I540V probably benign Het
Dock4 A G 12: 40,794,860 Y1174C probably damaging Het
Drd5 A G 5: 38,320,536 T291A probably damaging Het
Fam102a A G 2: 32,558,064 R62G probably benign Het
Fbn1 T C 2: 125,306,495 N2611S possibly damaging Het
Fhod3 A G 18: 25,060,352 E640G probably damaging Het
Flvcr2 T A 12: 85,805,239 D522E probably benign Het
Fuk A G 8: 110,895,897 I133T probably benign Het
Ganc T A 2: 120,441,529 I556K probably damaging Het
Gjc2 T A 11: 59,177,134 E174V unknown Het
Gm4869 A G 5: 140,462,188 T137A probably damaging Het
Gzmd G A 14: 56,131,342 R32C probably damaging Het
Hltf T A 3: 20,065,392 H200Q probably benign Het
Hrasls5 A G 19: 7,614,581 T121A probably benign Het
Ift88 A G 14: 57,479,997 I559M probably damaging Het
Ighv1-62-1 C A 12: 115,386,702 C115F probably damaging Het
Impdh2 A G 9: 108,563,437 N279S possibly damaging Het
Itpr1 T C 6: 108,517,620 probably null Het
Kansl1l T C 1: 66,801,628 N171S possibly damaging Het
Kif14 T A 1: 136,468,753 C266S probably benign Het
Lrriq1 A C 10: 103,215,973 V306G probably damaging Het
Mast4 G A 13: 103,334,000 R65W possibly damaging Het
Mex3d T C 10: 80,387,257 D55G Het
Mrps27 A T 13: 99,411,280 K233* probably null Het
Myo1f A G 17: 33,579,928 N189S probably damaging Het
Nbn A T 4: 15,991,190 K729N probably benign Het
Olfr1082 C A 2: 86,594,154 V225F possibly damaging Het
Olfr395 T C 11: 73,907,232 S87G probably benign Het
Park2 C A 17: 11,854,861 N355K possibly damaging Het
Pgghg T C 7: 140,945,720 S479P Het
Polr1e A C 4: 45,029,340 H315P probably damaging Het
Pou6f2 A G 13: 18,125,289 V595A Het
Prdm15 T C 16: 97,795,741 D960G possibly damaging Het
Prkcz A T 4: 155,269,059 M460K probably benign Het
Prkd2 G T 7: 16,857,805 R587L probably benign Het
Rabep1 C A 11: 70,939,989 T829N probably damaging Het
Rptn A G 3: 93,395,954 E198G probably benign Het
Ryr2 A T 13: 11,665,913 I3182N possibly damaging Het
Sectm1a T A 11: 121,069,882 I36F possibly damaging Het
Sez6l T C 5: 112,473,480 S243G probably benign Het
Taf2 T A 15: 55,062,141 H235L probably benign Het
Tbc1d7 T C 13: 43,153,017 Q161R probably benign Het
Tfcp2 T C 15: 100,518,587 T271A possibly damaging Het
Thrsp G T 7: 97,417,088 T139K probably damaging Het
Timm10 T A 2: 84,829,989 *91R probably null Het
Tlr11 T A 14: 50,362,141 I528N possibly damaging Het
Tnnt2 T A 1: 135,851,706 L278Q probably damaging Het
Toe1 A T 4: 116,807,518 M1K probably null Het
Trpv5 G A 6: 41,675,308 R148* probably null Het
Ttll13 A C 7: 80,254,163 K280Q probably damaging Het
Ttn A G 2: 76,953,206 V860A unknown Het
Txnip T C 3: 96,559,675 Y222H probably damaging Het
Ubr4 G A 4: 139,443,414 S1600N probably damaging Het
Uhrf1 T C 17: 56,315,193 Y364H probably damaging Het
Unc5a A T 13: 54,991,020 T71S probably damaging Het
Vmn1r123 A T 7: 21,162,612 Y143F possibly damaging Het
Vmn1r180 T A 7: 23,952,466 I18N probably damaging Het
Washc2 A G 6: 116,208,207 M1V probably null Het
Zfp174 C A 16: 3,848,247 H125Q probably benign Het
Zfpl1 T C 19: 6,081,913 H227R possibly damaging Het
Other mutations in Cyth4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00936:Cyth4 APN 15 78619913 missense probably benign 0.00
R0522:Cyth4 UTSW 15 78615785 missense possibly damaging 0.67
R0584:Cyth4 UTSW 15 78609878 splice site probably null
R2018:Cyth4 UTSW 15 78608171 missense probably damaging 1.00
R3804:Cyth4 UTSW 15 78609802 missense probably damaging 1.00
R3811:Cyth4 UTSW 15 78604649 missense probably damaging 1.00
R4728:Cyth4 UTSW 15 78602713 missense probably benign 0.01
R4738:Cyth4 UTSW 15 78605874 missense probably benign 0.02
R5392:Cyth4 UTSW 15 78606985 missense probably damaging 1.00
R5594:Cyth4 UTSW 15 78607075 unclassified probably null
R6414:Cyth4 UTSW 15 78608146 missense probably damaging 0.97
R7472:Cyth4 UTSW 15 78605894 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTGCAGTCTAAGTGTGC -3'
(R):5'- GTGAATGAATGAATATTCCAGAGCCTG -3'

Sequencing Primer
(F):5'- TGAGCATGCCTCCAGAGATG -3'
(R):5'- TGGTATGTTCACCCCTAC -3'
Posted On2019-06-26