Incidental Mutation 'R7242:Mfsd6'
ID563253
Institutional Source Beutler Lab
Gene Symbol Mfsd6
Ensembl Gene ENSMUSG00000041439
Gene Namemajor facilitator superfamily domain containing 6
SynonymsMMR2, 9630025I22Rik, 2210010L05Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_133829.2, NM_178081.4; MGI:1922925

Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R7242 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location52656286-52727462 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 52709474 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 77 (F77L)
Ref Sequence ENSEMBL: ENSMUSP00000084991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087701] [ENSMUST00000156876]
Predicted Effect probably damaging
Transcript: ENSMUST00000087701
AA Change: F77L

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000084991
Gene: ENSMUSG00000041439
AA Change: F77L

DomainStartEndE-ValueType
low complexity region 33 48 N/A INTRINSIC
Pfam:MFS_1_like 68 144 4.8e-19 PFAM
Pfam:MFS_1 70 162 7e-11 PFAM
Pfam:MFS_2 72 571 3.8e-13 PFAM
Pfam:Nuc_H_symport 424 628 1.1e-11 PFAM
Pfam:MFS_1 453 708 6.3e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147758
SMART Domains Protein: ENSMUSP00000115398
Gene: ENSMUSG00000041439

DomainStartEndE-ValueType
low complexity region 89 101 N/A INTRINSIC
transmembrane domain 120 142 N/A INTRINSIC
transmembrane domain 163 185 N/A INTRINSIC
transmembrane domain 200 219 N/A INTRINSIC
Pfam:Nuc_H_symport 255 459 1.4e-11 PFAM
Pfam:MFS_1 284 539 6.8e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000156876
AA Change: F77L

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122881
Gene: ENSMUSG00000041439
AA Change: F77L

DomainStartEndE-ValueType
low complexity region 33 48 N/A INTRINSIC
Pfam:MFS_1_like 68 144 6.2e-20 PFAM
Pfam:MFS_1 70 162 1.8e-10 PFAM
low complexity region 258 270 N/A INTRINSIC
transmembrane domain 289 311 N/A INTRINSIC
transmembrane domain 332 354 N/A INTRINSIC
transmembrane domain 369 388 N/A INTRINSIC
Pfam:Nuc_H_symport 424 628 2.6e-11 PFAM
Pfam:MFS_1 453 707 1.7e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (73/73)
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A T 6: 48,931,128 Y354F probably damaging Het
1700001J03Rik A T 5: 146,184,867 I74N probably damaging Het
4921501E09Rik A G 17: 33,067,127 Y234H probably damaging Het
Abca6 A T 11: 110,241,653 V272D possibly damaging Het
Acot11 A T 4: 106,762,493 S163R probably benign Het
Adcy5 T C 16: 35,156,835 L246P probably damaging Het
Adgra1 A T 7: 139,847,657 probably null Het
Adgra2 A G 8: 27,122,027 T1335A probably damaging Het
Armt1 T C 10: 4,453,475 S187P probably damaging Het
Azin1 T C 15: 38,501,505 M1V probably null Het
B430305J03Rik C T 3: 61,363,835 C163Y unknown Het
Cables1 T C 18: 11,840,007 S68P possibly damaging Het
Cacna1d A G 14: 30,178,706 F341L probably benign Het
Ccdc90b T A 7: 92,572,568 H118Q probably damaging Het
Celf1 T A 2: 91,003,257 C119* probably null Het
Cfap57 C T 4: 118,593,096 V610M possibly damaging Het
Chrm4 T A 2: 91,927,250 M1K probably null Het
Chrnd C T 1: 87,197,479 T418I probably damaging Het
Coch G T 12: 51,593,561 probably benign Het
Cop1 A G 1: 159,284,548 T345A probably benign Het
Cops6 A G 5: 138,163,580 T96A probably benign Het
Corin T C 5: 72,305,055 I945V probably benign Het
Cyp2c67 G T 19: 39,617,339 T371N probably benign Het
Dap T A 15: 31,273,308 *103R probably null Het
Defb35 T A 8: 21,940,757 V49E unknown Het
Dmtf1 T A 5: 9,149,016 D39V possibly damaging Het
Dmtn T C 14: 70,618,020 T10A probably damaging Het
Dnajc1 C T 2: 18,293,972 E264K probably benign Het
Dtx3l A T 16: 35,933,401 N278K possibly damaging Het
Fam161a T A 11: 23,020,037 S72T possibly damaging Het
Fnbp4 T A 2: 90,745,796 S114T unknown Het
Focad T G 4: 88,309,906 I784S unknown Het
Fzd8 A T 18: 9,214,171 T418S probably damaging Het
Gclc A G 9: 77,785,371 Y264C probably benign Het
Ggn G A 7: 29,173,034 C649Y possibly damaging Het
Gm10184 G A 17: 89,910,135 T61I probably benign Het
Gys1 A G 7: 45,439,668 probably null Het
Hsd3b1 T C 3: 98,853,210 Y155C probably damaging Het
Htatip2 A G 7: 49,772,606 K191E probably benign Het
Ik A T 18: 36,748,222 S79C probably null Het
Kin G A 2: 10,091,793 R151Q probably benign Het
Mast4 A G 13: 102,738,478 S1461P probably damaging Het
Melk T A 4: 44,360,885 V555E probably damaging Het
Met G A 6: 17,491,317 C26Y probably damaging Het
Mib1 T A 18: 10,741,011 D86E probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Olfr1120 G A 2: 87,358,082 V213I probably benign Het
Olfr1352 A T 10: 78,984,497 K236* probably null Het
Olfr504 T G 7: 108,565,712 S28R probably benign Het
Olfr935 A G 9: 38,995,141 I98T probably benign Het
Patj A T 4: 98,591,933 I1296L probably benign Het
Pcdh1 C T 18: 38,203,217 V122M probably benign Het
Pcdhac2 A T 18: 37,144,893 I309F possibly damaging Het
Phtf1 A G 3: 103,998,696 S565G probably damaging Het
Plekha2 A C 8: 25,088,395 F30V probably damaging Het
Ptbp1 A G 10: 79,856,388 M20V unknown Het
Pth2r A G 1: 65,388,620 D484G probably benign Het
Rapgef2 G A 3: 79,087,903 Q665* probably null Het
Scamp1 G A 13: 94,233,140 T59I probably benign Het
Sema4a T A 3: 88,450,109 D230V probably damaging Het
Snw1 C T 12: 87,468,645 G45R possibly damaging Het
Sox30 T A 11: 45,984,520 probably null Het
Sspo T A 6: 48,473,952 I2665K probably benign Het
Stx5a T A 19: 8,755,277 W437R unknown Het
Tln1 A G 4: 43,542,602 V1402A probably benign Het
Tpm1 A G 9: 67,028,101 L244P probably benign Het
Try5 T A 6: 41,313,454 E32V probably benign Het
Ttn T C 2: 76,721,729 N31188S probably benign Het
Tulp1 T C 17: 28,363,405 probably null Het
Usp13 T G 3: 32,865,743 probably null Het
Vax2 A G 6: 83,711,316 E7G possibly damaging Het
Vmn2r45 A T 7: 8,485,613 Y139* probably null Het
Wisp2 T C 2: 163,828,852 F93S probably benign Het
Zfp423 T C 8: 87,904,527 D21G probably benign Het
Other mutations in Mfsd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Mfsd6 APN 1 52708254 missense probably damaging 1.00
IGL00820:Mfsd6 APN 1 52708306 missense probably damaging 1.00
IGL01518:Mfsd6 APN 1 52709322 missense probably damaging 1.00
IGL02111:Mfsd6 APN 1 52708344 missense probably damaging 1.00
IGL02517:Mfsd6 APN 1 52663277 splice site probably benign
IGL02687:Mfsd6 APN 1 52708675 missense probably damaging 0.99
IGL02887:Mfsd6 APN 1 52708878 missense probably benign 0.19
IGL02901:Mfsd6 APN 1 52708473 missense probably benign 0.07
IGL03030:Mfsd6 APN 1 52709703 start codon destroyed probably null 1.00
PIT4280001:Mfsd6 UTSW 1 52660880 missense probably benign 0.00
PIT4466001:Mfsd6 UTSW 1 52708897 missense probably benign 0.03
R0043:Mfsd6 UTSW 1 52708652 nonsense probably null
R0113:Mfsd6 UTSW 1 52709189 missense probably damaging 1.00
R0226:Mfsd6 UTSW 1 52658690 intron probably benign
R0302:Mfsd6 UTSW 1 52709457 missense probably damaging 1.00
R0613:Mfsd6 UTSW 1 52658696 intron probably benign
R1126:Mfsd6 UTSW 1 52709511 missense probably benign 0.16
R1368:Mfsd6 UTSW 1 52708605 missense possibly damaging 0.49
R1471:Mfsd6 UTSW 1 52709557 missense probably benign 0.32
R1733:Mfsd6 UTSW 1 52709365 missense probably damaging 1.00
R1768:Mfsd6 UTSW 1 52660805 critical splice donor site probably null
R1951:Mfsd6 UTSW 1 52709358 missense probably damaging 1.00
R2031:Mfsd6 UTSW 1 52708854 missense probably benign 0.04
R2116:Mfsd6 UTSW 1 52660975 missense probably benign 0.21
R2240:Mfsd6 UTSW 1 52660819 missense probably damaging 0.97
R2242:Mfsd6 UTSW 1 52709598 missense probably benign 0.03
R2303:Mfsd6 UTSW 1 52676513 missense probably damaging 0.98
R2382:Mfsd6 UTSW 1 52708410 missense probably benign 0.10
R4568:Mfsd6 UTSW 1 52663289 nonsense probably null
R4801:Mfsd6 UTSW 1 52709596 missense probably benign 0.08
R4802:Mfsd6 UTSW 1 52709596 missense probably benign 0.08
R4958:Mfsd6 UTSW 1 52661024 missense probably damaging 1.00
R5134:Mfsd6 UTSW 1 52708356 missense possibly damaging 0.80
R5827:Mfsd6 UTSW 1 52662392 missense probably damaging 1.00
R5844:Mfsd6 UTSW 1 52658383 missense probably benign
R6124:Mfsd6 UTSW 1 52708252 missense probably damaging 1.00
R6435:Mfsd6 UTSW 1 52709444 nonsense probably null
R6515:Mfsd6 UTSW 1 52660961 missense probably damaging 1.00
R6874:Mfsd6 UTSW 1 52660709 missense probably benign 0.02
R6878:Mfsd6 UTSW 1 52708753 missense probably damaging 0.98
R7111:Mfsd6 UTSW 1 52709758 splice site probably null
R7170:Mfsd6 UTSW 1 52662388 critical splice donor site probably null
R7548:Mfsd6 UTSW 1 52663287 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- CAAATCCAATGCCCAGGTTG -3'
(R):5'- AAATATGTGCTTGCTGATCCCTTC -3'

Sequencing Primer
(F):5'- AGAGGAGGACAATTTTGCCC -3'
(R):5'- CTTCAATGGCATCTGCAGGGAAC -3'
Posted On2019-06-26