Incidental Mutation 'R7242:Tln1'
ID563270
Institutional Source Beutler Lab
Gene Symbol Tln1
Ensembl Gene ENSMUSG00000028465
Gene Nametalin 1
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7242 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location43531519-43562691 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43542602 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1402 (V1402A)
Ref Sequence ENSEMBL: ENSMUSP00000030187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030187]
PDB Structure
Crystal Structure of Talin Rod 482-655 [X-RAY DIFFRACTION]
Crystal Structure of talin residues 482-789 [X-RAY DIFFRACTION]
Vinculin complexed with the VBS1 helix from talin [X-RAY DIFFRACTION]
Solution structure of VBS2 fragment of talin [SOLUTION NMR]
[]
Structural basis for phosphatidylinositol phosphate kinase type I-gamma binding to talin at focal adhesions [X-RAY DIFFRACTION]
Vinculin Head (0-258) in Complex with the Talin Rod residues 1630-1652 [X-RAY DIFFRACTION]
Solution structure of VBS3 fragment of talin [SOLUTION NMR]
NMR structure of talin-PTB in complex with PIPKI [SOLUTION NMR]
NMR structure of the talin C-terminal actin binding site [SOLUTION NMR]
>> 17 additional structures at PDB <<
Predicted Effect probably benign
Transcript: ENSMUST00000030187
AA Change: V1402A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000030187
Gene: ENSMUSG00000028465
AA Change: V1402A

DomainStartEndE-ValueType
Blast:B41 2 76 5e-31 BLAST
B41 82 313 4.66e-73 SMART
IRS 308 401 7.65e-16 SMART
Pfam:Talin_middle 491 652 8.2e-60 PFAM
low complexity region 671 690 N/A INTRINSIC
internal_repeat_2 699 760 8.94e-6 PROSPERO
low complexity region 766 775 N/A INTRINSIC
PDB:1ZVZ|B 820 844 2e-7 PDB
low complexity region 866 879 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
PDB:2LQG|A 913 1044 2e-44 PDB
PDB:2L7N|A 1046 1207 1e-101 PDB
Pfam:VBS 1234 1358 9.6e-8 PFAM
internal_repeat_2 1488 1549 8.94e-6 PROSPERO
internal_repeat_3 1623 1769 4.92e-5 PROSPERO
low complexity region 1817 1828 N/A INTRINSIC
Pfam:VBS 1849 1973 6.2e-67 PFAM
PDB:3DYJ|B 1974 2293 N/A PDB
low complexity region 2305 2327 N/A INTRINSIC
ILWEQ 2336 2533 2.93e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125509
SMART Domains Protein: ENSMUSP00000115681
Gene: ENSMUSG00000028465

DomainStartEndE-ValueType
Blast:IRS 2 28 2e-9 BLAST
PDB:2G35|A 2 29 3e-11 PDB
Pfam:Talin_middle 32 193 1.8e-61 PFAM
PDB:2L7A|A 215 279 1e-38 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000134623
SMART Domains Protein: ENSMUSP00000119956
Gene: ENSMUSG00000028465

DomainStartEndE-ValueType
PDB:1U89|A 2 106 9e-50 PDB
low complexity region 107 120 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein that is concentrated in areas of cell-substratum and cell-cell contacts. The encoded protein plays a significant role in the assembly of actin filaments and in spreading and migration of various cell types, including fibroblasts and osteoclasts. It codistributes with integrins in the cell surface membrane in order to assist in the attachment of adherent cells to extracellular matrices and of lymphocytes to other cells. The N-terminus of this protein contains elements for localization to cell-extracellular matrix junctions. The C-terminus contains binding sites for proteins such as beta-1-integrin, actin, and vinculin. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for either one of two knock-out alleles display early developmental anomalies, reduced embryo size, and embryonic lethality due to impaired cell migration at the gastrulation stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A T 6: 48,931,128 Y354F probably damaging Het
1700001J03Rik A T 5: 146,184,867 I74N probably damaging Het
4921501E09Rik A G 17: 33,067,127 Y234H probably damaging Het
Abca6 A T 11: 110,241,653 V272D possibly damaging Het
Acot11 A T 4: 106,762,493 S163R probably benign Het
Adcy5 T C 16: 35,156,835 L246P probably damaging Het
Adgra1 A T 7: 139,847,657 probably null Het
Adgra2 A G 8: 27,122,027 T1335A probably damaging Het
Armt1 T C 10: 4,453,475 S187P probably damaging Het
Azin1 T C 15: 38,501,505 M1V probably null Het
B430305J03Rik C T 3: 61,363,835 C163Y unknown Het
Cacna1d A G 14: 30,178,706 F341L probably benign Het
Ccdc90b T A 7: 92,572,568 H118Q probably damaging Het
Celf1 T A 2: 91,003,257 C119* probably null Het
Cfap57 C T 4: 118,593,096 V610M possibly damaging Het
Chrm4 T A 2: 91,927,250 M1K probably null Het
Chrnd C T 1: 87,197,479 T418I probably damaging Het
Coch G T 12: 51,593,561 probably benign Het
Cop1 A G 1: 159,284,548 T345A probably benign Het
Cops6 A G 5: 138,163,580 T96A probably benign Het
Corin T C 5: 72,305,055 I945V probably benign Het
Cyp2c67 G T 19: 39,617,339 T371N probably benign Het
Dap T A 15: 31,273,308 *103R probably null Het
Defb35 T A 8: 21,940,757 V49E unknown Het
Dmtf1 T A 5: 9,149,016 D39V possibly damaging Het
Dmtn T C 14: 70,618,020 T10A probably damaging Het
Dnajc1 C T 2: 18,293,972 E264K probably benign Het
Dtx3l A T 16: 35,933,401 N278K possibly damaging Het
Fam161a T A 11: 23,020,037 S72T possibly damaging Het
Fnbp4 T A 2: 90,745,796 S114T unknown Het
Focad T G 4: 88,309,906 I784S unknown Het
Fzd8 A T 18: 9,214,171 T418S probably damaging Het
Gclc A G 9: 77,785,371 Y264C probably benign Het
Ggn G A 7: 29,173,034 C649Y possibly damaging Het
Gm10184 G A 17: 89,910,135 T61I probably benign Het
Hsd3b1 T C 3: 98,853,210 Y155C probably damaging Het
Htatip2 A G 7: 49,772,606 K191E probably benign Het
Ik A T 18: 36,748,222 S79C probably null Het
Kin G A 2: 10,091,793 R151Q probably benign Het
Mast4 A G 13: 102,738,478 S1461P probably damaging Het
Melk T A 4: 44,360,885 V555E probably damaging Het
Met G A 6: 17,491,317 C26Y probably damaging Het
Mfsd6 A T 1: 52,709,474 F77L probably damaging Het
Mib1 T A 18: 10,741,011 D86E probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Olfr1120 G A 2: 87,358,082 V213I probably benign Het
Olfr1352 A T 10: 78,984,497 K236* probably null Het
Olfr504 T G 7: 108,565,712 S28R probably benign Het
Olfr935 A G 9: 38,995,141 I98T probably benign Het
Patj A T 4: 98,591,933 I1296L probably benign Het
Pcdh1 C T 18: 38,203,217 V122M probably benign Het
Pcdhac2 A T 18: 37,144,893 I309F possibly damaging Het
Phtf1 A G 3: 103,998,696 S565G probably damaging Het
Plekha2 A C 8: 25,088,395 F30V probably damaging Het
Ptbp1 A G 10: 79,856,388 M20V unknown Het
Pth2r A G 1: 65,388,620 D484G probably benign Het
Rapgef2 G A 3: 79,087,903 Q665* probably null Het
Scamp1 G A 13: 94,233,140 T59I probably benign Het
Sema4a T A 3: 88,450,109 D230V probably damaging Het
Snw1 C T 12: 87,468,645 G45R possibly damaging Het
Sspo T A 6: 48,473,952 I2665K probably benign Het
Stx5a T A 19: 8,755,277 W437R unknown Het
Tpm1 A G 9: 67,028,101 L244P probably benign Het
Try5 T A 6: 41,313,454 E32V probably benign Het
Ttn T C 2: 76,721,729 N31188S probably benign Het
Vax2 A G 6: 83,711,316 E7G possibly damaging Het
Vmn2r45 A T 7: 8,485,613 Y139* probably null Het
Wisp2 T C 2: 163,828,852 F93S probably benign Het
Zfp423 T C 8: 87,904,527 D21G probably benign Het
Other mutations in Tln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Tln1 APN 4 43542719 missense probably benign 0.22
IGL00987:Tln1 APN 4 43551297 unclassified probably benign
IGL01345:Tln1 APN 4 43536281 missense probably damaging 1.00
IGL01456:Tln1 APN 4 43543432 unclassified probably benign
IGL01715:Tln1 APN 4 43555890 missense probably damaging 1.00
IGL01750:Tln1 APN 4 43545435 missense probably damaging 1.00
IGL01933:Tln1 APN 4 43539508 missense probably benign
IGL01933:Tln1 APN 4 43555894 missense possibly damaging 0.52
IGL02119:Tln1 APN 4 43546760 missense probably damaging 0.99
IGL02148:Tln1 APN 4 43555388 missense probably damaging 1.00
IGL02153:Tln1 APN 4 43546857 missense possibly damaging 0.76
IGL02522:Tln1 APN 4 43540612 missense probably benign 0.07
IGL02691:Tln1 APN 4 43539544 missense probably benign 0.42
IGL02882:Tln1 APN 4 43539522 missense probably benign 0.45
IGL02892:Tln1 APN 4 43555679 missense probably damaging 1.00
IGL03061:Tln1 APN 4 43545694 missense probably damaging 1.00
IGL03102:Tln1 APN 4 43532861 missense possibly damaging 0.89
IGL03183:Tln1 APN 4 43539084 splice site probably benign
H8786:Tln1 UTSW 4 43544589 missense probably damaging 0.97
PIT4576001:Tln1 UTSW 4 43539998 missense probably damaging 1.00
PIT4696001:Tln1 UTSW 4 43542701 critical splice donor site probably null
R0206:Tln1 UTSW 4 43549151 missense probably damaging 1.00
R0208:Tln1 UTSW 4 43549151 missense probably damaging 1.00
R0454:Tln1 UTSW 4 43553504 missense probably benign
R0539:Tln1 UTSW 4 43543434 critical splice donor site probably null
R0548:Tln1 UTSW 4 43542709 missense possibly damaging 0.79
R0561:Tln1 UTSW 4 43550304 missense possibly damaging 0.94
R0606:Tln1 UTSW 4 43547756 missense probably benign 0.34
R0607:Tln1 UTSW 4 43553071 missense probably damaging 1.00
R0609:Tln1 UTSW 4 43544645 missense possibly damaging 0.63
R0847:Tln1 UTSW 4 43555333 missense probably damaging 1.00
R0993:Tln1 UTSW 4 43549825 missense probably benign 0.22
R1255:Tln1 UTSW 4 43538044 missense probably damaging 1.00
R1292:Tln1 UTSW 4 43534578 critical splice donor site probably null
R1752:Tln1 UTSW 4 43536311 missense probably damaging 1.00
R2169:Tln1 UTSW 4 43548005 missense probably damaging 1.00
R2172:Tln1 UTSW 4 43545721 missense probably benign
R2202:Tln1 UTSW 4 43553083 unclassified probably null
R2680:Tln1 UTSW 4 43539668 missense probably damaging 1.00
R3012:Tln1 UTSW 4 43542525 missense probably benign
R3714:Tln1 UTSW 4 43540597 missense probably damaging 1.00
R3735:Tln1 UTSW 4 43549370 missense probably damaging 0.97
R3794:Tln1 UTSW 4 43536295 missense probably damaging 1.00
R3825:Tln1 UTSW 4 43536413 splice site probably benign
R3983:Tln1 UTSW 4 43553030 missense probably damaging 1.00
R4061:Tln1 UTSW 4 43549177 missense probably damaging 1.00
R4249:Tln1 UTSW 4 43536104 missense probably damaging 1.00
R4287:Tln1 UTSW 4 43543509 missense probably benign 0.01
R4471:Tln1 UTSW 4 43551018 missense probably benign 0.03
R4562:Tln1 UTSW 4 43533598 missense probably damaging 1.00
R4654:Tln1 UTSW 4 43535954 missense probably null 1.00
R4737:Tln1 UTSW 4 43540588 missense probably benign 0.00
R4936:Tln1 UTSW 4 43547522 missense possibly damaging 0.83
R5225:Tln1 UTSW 4 43539406 missense probably benign 0.06
R5288:Tln1 UTSW 4 43540661 missense probably benign 0.06
R5421:Tln1 UTSW 4 43533609 missense possibly damaging 0.80
R5445:Tln1 UTSW 4 43543905 missense probably benign 0.26
R5660:Tln1 UTSW 4 43547732 missense probably damaging 1.00
R5772:Tln1 UTSW 4 43545191 missense probably benign 0.13
R6012:Tln1 UTSW 4 43539508 missense probably benign
R6038:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6038:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6039:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6039:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6052:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6145:Tln1 UTSW 4 43538030 missense possibly damaging 0.64
R6157:Tln1 UTSW 4 43534744 missense probably benign 0.06
R6242:Tln1 UTSW 4 43533145 missense probably damaging 1.00
R6454:Tln1 UTSW 4 43533866 missense probably damaging 0.99
R6467:Tln1 UTSW 4 43543165 missense probably benign 0.42
R6548:Tln1 UTSW 4 43547525 missense probably damaging 0.98
R6576:Tln1 UTSW 4 43555419 splice site probably null
R6722:Tln1 UTSW 4 43547618 missense probably damaging 1.00
R6968:Tln1 UTSW 4 43550217 missense probably benign 0.02
R7000:Tln1 UTSW 4 43556302 missense probably damaging 0.96
R7137:Tln1 UTSW 4 43540616 missense probably damaging 1.00
R7294:Tln1 UTSW 4 43534399 missense probably benign 0.02
R7312:Tln1 UTSW 4 43545922 missense probably damaging 1.00
X0052:Tln1 UTSW 4 43533125 critical splice donor site probably null
X0063:Tln1 UTSW 4 43548015 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCAGATCTCACATGAGCTTCTTG -3'
(R):5'- TCCGAGAACTCCTGGAGAATC -3'

Sequencing Primer
(F):5'- CTCACATGAGCTTCTTGATTTATAGC -3'
(R):5'- TGGAGAATCCAGTCCAGCC -3'
Posted On2019-06-26