Incidental Mutation 'R0578:4930407I10Rik'
ID56329
Institutional Source Beutler Lab
Gene Symbol 4930407I10Rik
Ensembl Gene ENSMUSG00000075524
Gene NameRIKEN cDNA 4930407I10 gene
SynonymsLOC328573
MMRRC Submission 038768-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R0578 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location82059151-82066540 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82059355 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 56 (Y56C)
Ref Sequence ENSEMBL: ENSMUSP00000097965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100396]
Predicted Effect possibly damaging
Transcript: ENSMUST00000100396
AA Change: Y56C

PolyPhen 2 Score 0.491 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097965
Gene: ENSMUSG00000075524
AA Change: Y56C

DomainStartEndE-ValueType
Pfam:DUF4727 25 234 1.1e-109 PFAM
internal_repeat_1 321 406 9.89e-8 PROSPERO
low complexity region 453 465 N/A INTRINSIC
internal_repeat_2 593 707 6.03e-6 PROSPERO
low complexity region 735 752 N/A INTRINSIC
low complexity region 758 773 N/A INTRINSIC
internal_repeat_2 842 958 6.03e-6 PROSPERO
internal_repeat_1 876 962 9.89e-8 PROSPERO
low complexity region 985 996 N/A INTRINSIC
low complexity region 1117 1133 N/A INTRINSIC
low complexity region 1143 1156 N/A INTRINSIC
low complexity region 1199 1208 N/A INTRINSIC
low complexity region 1259 1270 N/A INTRINSIC
low complexity region 1282 1296 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229578
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231081
Meta Mutation Damage Score 0.0632 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,276,489 C1500* probably null Het
Acr C G 15: 89,569,475 H72Q probably damaging Het
Adam18 T C 8: 24,641,847 D416G possibly damaging Het
Afap1l2 T A 19: 56,915,782 Y691F probably benign Het
Akna A G 4: 63,370,910 S1259P probably benign Het
Atad2 G A 15: 58,105,568 T525I probably damaging Het
Atp2a1 T G 7: 126,450,143 M576L probably benign Het
B4galt6 T C 18: 20,727,956 probably benign Het
Best3 A G 10: 117,008,999 D353G probably benign Het
Btg3 A T 16: 78,364,946 D125E probably benign Het
C87499 T A 4: 88,634,139 I2F probably benign Het
Cabin1 A T 10: 75,713,610 D1320E probably damaging Het
Cachd1 A C 4: 100,994,842 probably benign Het
Cad T C 5: 31,058,776 V151A probably benign Het
Capns1 A T 7: 30,194,028 probably benign Het
Catsperg2 T A 7: 29,704,691 T860S possibly damaging Het
Ccdc61 T C 7: 18,903,475 T76A probably benign Het
Cdipt T A 7: 126,979,530 probably null Het
Cyp2d12 G A 15: 82,556,383 probably benign Het
Dennd4c C A 4: 86,812,422 P852Q probably damaging Het
Dsg2 G A 18: 20,594,234 V613I probably benign Het
Dusp16 G C 6: 134,718,321 L516V probably damaging Het
Eif2ak4 T G 2: 118,474,991 probably benign Het
Faf2 C T 13: 54,621,845 A2V possibly damaging Het
Gas2l3 A G 10: 89,417,075 I236T probably damaging Het
Gm6605 C A 7: 38,448,275 noncoding transcript Het
Got1 G T 19: 43,515,783 S66R probably benign Het
Gpr149 T A 3: 62,602,689 H335L possibly damaging Het
Hadhb A G 5: 30,178,806 I342M probably benign Het
Helz T A 11: 107,686,400 V1859D unknown Het
Htr1a T A 13: 105,445,087 N278K probably damaging Het
Inppl1 T C 7: 101,831,588 E355G probably damaging Het
Isl2 A G 9: 55,545,035 Y297C probably damaging Het
Kat7 T C 11: 95,291,524 H250R probably benign Het
Klhl30 A T 1: 91,354,352 D225V probably benign Het
Mtch2 T C 2: 90,852,830 probably benign Het
Muc4 C A 16: 32,755,690 probably benign Het
Ncoa7 A C 10: 30,701,917 probably null Het
Nuf2 T A 1: 169,510,549 probably benign Het
Olfr767 A G 10: 129,079,193 Y257H probably damaging Het
Olfr994 T C 2: 85,430,673 D52G probably benign Het
Pced1a T A 2: 130,419,843 S297C probably damaging Het
Pi15 A T 1: 17,602,849 K91* probably null Het
Pla2g4e C T 2: 120,244,681 probably benign Het
Plce1 A T 19: 38,777,939 H2136L probably damaging Het
Plec A G 15: 76,176,884 L2973P probably damaging Het
Poln A G 5: 34,014,338 I695T probably damaging Het
R3hdm1 C T 1: 128,231,437 Q950* probably null Het
Rxra C T 2: 27,759,570 A429V probably damaging Het
Scnn1a G A 6: 125,322,244 G96S probably damaging Het
Senp5 T A 16: 31,989,345 T337S possibly damaging Het
Smg9 A G 7: 24,415,043 D269G probably damaging Het
Srsf11 C T 3: 158,012,067 probably benign Het
Tmtc1 C T 6: 148,355,218 probably benign Het
Vmn2r19 T C 6: 123,335,972 V667A probably damaging Het
Other mutations in 4930407I10Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:4930407I10Rik APN 15 82066380 missense probably benign 0.00
IGL02135:4930407I10Rik APN 15 82065004 missense possibly damaging 0.63
IGL02367:4930407I10Rik APN 15 82065547 missense probably benign 0.00
IGL02626:4930407I10Rik APN 15 82065609 missense probably damaging 0.99
IGL02885:4930407I10Rik APN 15 82063951 missense probably benign 0.36
IGL03199:4930407I10Rik APN 15 82062355 missense possibly damaging 0.65
R0062:4930407I10Rik UTSW 15 82063066 missense probably benign 0.00
R0062:4930407I10Rik UTSW 15 82066303 missense probably damaging 0.98
R0086:4930407I10Rik UTSW 15 82062601 missense probably benign 0.11
R1130:4930407I10Rik UTSW 15 82059360 missense probably benign
R1218:4930407I10Rik UTSW 15 82064152 missense probably benign 0.04
R1942:4930407I10Rik UTSW 15 82065424 missense probably damaging 0.98
R2380:4930407I10Rik UTSW 15 82064835 missense possibly damaging 0.92
R3945:4930407I10Rik UTSW 15 82065400 missense probably damaging 1.00
R4096:4930407I10Rik UTSW 15 82062205 missense probably benign 0.07
R4259:4930407I10Rik UTSW 15 82063726 missense possibly damaging 0.89
R4261:4930407I10Rik UTSW 15 82063726 missense possibly damaging 0.89
R4805:4930407I10Rik UTSW 15 82066427 nonsense probably null
R4992:4930407I10Rik UTSW 15 82064002 missense possibly damaging 0.60
R5094:4930407I10Rik UTSW 15 82062682 missense possibly damaging 0.72
R5161:4930407I10Rik UTSW 15 82063341 nonsense probably null
R5201:4930407I10Rik UTSW 15 82062544 missense probably benign 0.26
R5305:4930407I10Rik UTSW 15 82059219 missense possibly damaging 0.52
R5588:4930407I10Rik UTSW 15 82065216 missense possibly damaging 0.83
R5844:4930407I10Rik UTSW 15 82065864 missense probably benign 0.33
R6007:4930407I10Rik UTSW 15 82062739 missense probably benign 0.13
R6157:4930407I10Rik UTSW 15 82063416 missense possibly damaging 0.67
R6188:4930407I10Rik UTSW 15 82059270 missense probably benign 0.01
R6350:4930407I10Rik UTSW 15 82063563 missense possibly damaging 0.55
R6408:4930407I10Rik UTSW 15 82065106 missense possibly damaging 0.77
R6805:4930407I10Rik UTSW 15 82062543 missense possibly damaging 0.95
R6911:4930407I10Rik UTSW 15 82063867 missense probably benign 0.01
R6962:4930407I10Rik UTSW 15 82064949 missense probably benign 0.14
R7446:4930407I10Rik UTSW 15 82066240 missense probably benign
X0011:4930407I10Rik UTSW 15 82059285 missense probably damaging 1.00
X0026:4930407I10Rik UTSW 15 82063311 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCAGCTACATCAGCCTGTGTTTC -3'
(R):5'- GGTGCTTATACAGAGCAGTCCATGC -3'

Sequencing Primer
(F):5'- GACCTAAGCCTTGCCATGTTG -3'
(R):5'- TCCATGCAGCATGTGGCTAA -3'
Posted On2013-07-11