Incidental Mutation 'R0578:Cyp2d12'
ID56330
Institutional Source Beutler Lab
Gene Symbol Cyp2d12
Ensembl Gene ENSMUSG00000096852
Gene Namecytochrome P450, family 2, subfamily d, polypeptide 12
Synonyms
MMRRC Submission 038768-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R0578 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location82555072-82560403 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 82556383 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068861] [ENSMUST00000228974] [ENSMUST00000229103] [ENSMUST00000229904]
Predicted Effect probably benign
Transcript: ENSMUST00000068861
SMART Domains Protein: ENSMUSP00000071064
Gene: ENSMUSG00000096852

DomainStartEndE-ValueType
transmembrane domain 4 23 N/A INTRINSIC
Pfam:p450 37 497 3.6e-143 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184191
Predicted Effect probably benign
Transcript: ENSMUST00000228974
Predicted Effect probably benign
Transcript: ENSMUST00000229103
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229792
Predicted Effect probably benign
Transcript: ENSMUST00000229904
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229988
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230859
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,059,355 Y56C possibly damaging Het
Abca5 A T 11: 110,276,489 C1500* probably null Het
Acr C G 15: 89,569,475 H72Q probably damaging Het
Adam18 T C 8: 24,641,847 D416G possibly damaging Het
Afap1l2 T A 19: 56,915,782 Y691F probably benign Het
Akna A G 4: 63,370,910 S1259P probably benign Het
Atad2 G A 15: 58,105,568 T525I probably damaging Het
Atp2a1 T G 7: 126,450,143 M576L probably benign Het
B4galt6 T C 18: 20,727,956 probably benign Het
Best3 A G 10: 117,008,999 D353G probably benign Het
Btg3 A T 16: 78,364,946 D125E probably benign Het
C87499 T A 4: 88,634,139 I2F probably benign Het
Cabin1 A T 10: 75,713,610 D1320E probably damaging Het
Cachd1 A C 4: 100,994,842 probably benign Het
Cad T C 5: 31,058,776 V151A probably benign Het
Capns1 A T 7: 30,194,028 probably benign Het
Catsperg2 T A 7: 29,704,691 T860S possibly damaging Het
Ccdc61 T C 7: 18,903,475 T76A probably benign Het
Cdipt T A 7: 126,979,530 probably null Het
Dennd4c C A 4: 86,812,422 P852Q probably damaging Het
Dsg2 G A 18: 20,594,234 V613I probably benign Het
Dusp16 G C 6: 134,718,321 L516V probably damaging Het
Eif2ak4 T G 2: 118,474,991 probably benign Het
Faf2 C T 13: 54,621,845 A2V possibly damaging Het
Gas2l3 A G 10: 89,417,075 I236T probably damaging Het
Gm6605 C A 7: 38,448,275 noncoding transcript Het
Got1 G T 19: 43,515,783 S66R probably benign Het
Gpr149 T A 3: 62,602,689 H335L possibly damaging Het
Hadhb A G 5: 30,178,806 I342M probably benign Het
Helz T A 11: 107,686,400 V1859D unknown Het
Htr1a T A 13: 105,445,087 N278K probably damaging Het
Inppl1 T C 7: 101,831,588 E355G probably damaging Het
Isl2 A G 9: 55,545,035 Y297C probably damaging Het
Kat7 T C 11: 95,291,524 H250R probably benign Het
Klhl30 A T 1: 91,354,352 D225V probably benign Het
Mtch2 T C 2: 90,852,830 probably benign Het
Muc4 C A 16: 32,755,690 probably benign Het
Ncoa7 A C 10: 30,701,917 probably null Het
Nuf2 T A 1: 169,510,549 probably benign Het
Olfr767 A G 10: 129,079,193 Y257H probably damaging Het
Olfr994 T C 2: 85,430,673 D52G probably benign Het
Pced1a T A 2: 130,419,843 S297C probably damaging Het
Pi15 A T 1: 17,602,849 K91* probably null Het
Pla2g4e C T 2: 120,244,681 probably benign Het
Plce1 A T 19: 38,777,939 H2136L probably damaging Het
Plec A G 15: 76,176,884 L2973P probably damaging Het
Poln A G 5: 34,014,338 I695T probably damaging Het
R3hdm1 C T 1: 128,231,437 Q950* probably null Het
Rxra C T 2: 27,759,570 A429V probably damaging Het
Scnn1a G A 6: 125,322,244 G96S probably damaging Het
Senp5 T A 16: 31,989,345 T337S possibly damaging Het
Smg9 A G 7: 24,415,043 D269G probably damaging Het
Srsf11 C T 3: 158,012,067 probably benign Het
Tmtc1 C T 6: 148,355,218 probably benign Het
Vmn2r19 T C 6: 123,335,972 V667A probably damaging Het
Other mutations in Cyp2d12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01959:Cyp2d12 APN 15 82555344 splice site probably benign
IGL02318:Cyp2d12 APN 15 82555243 missense probably benign 0.33
IGL02353:Cyp2d12 APN 15 82558970 missense probably benign 0.02
IGL02360:Cyp2d12 APN 15 82558970 missense probably benign 0.02
IGL02491:Cyp2d12 APN 15 82558481 missense possibly damaging 0.88
IGL02651:Cyp2d12 APN 15 82556740 missense probably damaging 0.99
IGL02664:Cyp2d12 APN 15 82559334 missense probably benign
IGL03169:Cyp2d12 APN 15 82559291 missense probably benign 0.00
IGL03354:Cyp2d12 APN 15 82558961 missense probably damaging 1.00
PIT4581001:Cyp2d12 UTSW 15 82558451 missense probably damaging 1.00
R0426:Cyp2d12 UTSW 15 82558963 missense probably benign 0.12
R1297:Cyp2d12 UTSW 15 82557686 missense probably benign 0.31
R1517:Cyp2d12 UTSW 15 82558136 missense probably damaging 1.00
R1718:Cyp2d12 UTSW 15 82558050 missense probably benign 0.00
R1829:Cyp2d12 UTSW 15 82558056 missense possibly damaging 0.87
R2208:Cyp2d12 UTSW 15 82556936 missense probably damaging 1.00
R2366:Cyp2d12 UTSW 15 82555154 missense probably damaging 1.00
R2385:Cyp2d12 UTSW 15 82558495 missense probably benign 0.00
R2504:Cyp2d12 UTSW 15 82559036 missense probably benign 0.06
R4009:Cyp2d12 UTSW 15 82556292 missense probably damaging 1.00
R4940:Cyp2d12 UTSW 15 82558050 missense probably benign 0.00
R5237:Cyp2d12 UTSW 15 82558006 splice site probably null
R5327:Cyp2d12 UTSW 15 82555222 missense probably benign 0.00
R5549:Cyp2d12 UTSW 15 82556297 missense probably benign 0.23
R6128:Cyp2d12 UTSW 15 82558965 missense probably benign
R6275:Cyp2d12 UTSW 15 82556658 missense probably benign 0.00
R6723:Cyp2d12 UTSW 15 82556884 missense probably benign
R6808:Cyp2d12 UTSW 15 82556733 missense probably damaging 1.00
R6947:Cyp2d12 UTSW 15 82559047 missense probably benign
R7137:Cyp2d12 UTSW 15 82557821 missense probably benign 0.42
X0065:Cyp2d12 UTSW 15 82557828 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GTTTAGCCTACAGATGGCCTGGAAG -3'
(R):5'- CAAAGAGAATCGCCTCTGCTCTCG -3'

Sequencing Primer
(F):5'- CAGATGGCCTGGAAGCCTATG -3'
(R):5'- CAAGAATGTCCAGATGTGCTGTC -3'
Posted On2013-07-11