Incidental Mutation 'R7242:Ptbp1'
ID563301
Institutional Source Beutler Lab
Gene Symbol Ptbp1
Ensembl Gene ENSMUSG00000006498
Gene Namepolypyrimidine tract binding protein 1
SynonymsPtb, hnRNP I
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7242 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location79854427-79864771 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79856388 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 20 (M20V)
Ref Sequence ENSEMBL: ENSMUSP00000131296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057343] [ENSMUST00000095457] [ENSMUST00000165704] [ENSMUST00000165724] [ENSMUST00000167250] [ENSMUST00000168683] [ENSMUST00000169483] [ENSMUST00000171599] [ENSMUST00000172282]
Predicted Effect probably benign
Transcript: ENSMUST00000057343
SMART Domains Protein: ENSMUSP00000059481
Gene: ENSMUSG00000006498

DomainStartEndE-ValueType
low complexity region 32 38 N/A INTRINSIC
RRM 59 128 9.8e-9 SMART
low complexity region 161 178 N/A INTRINSIC
RRM 184 253 4.75e-7 SMART
low complexity region 305 330 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095457
SMART Domains Protein: ENSMUSP00000093109
Gene: ENSMUSG00000006498

DomainStartEndE-ValueType
Pfam:RRM_6 36 86 1.9e-5 PFAM
Pfam:RRM_5 38 90 3.6e-12 PFAM
low complexity region 121 138 N/A INTRINSIC
RRM 144 213 4.75e-7 SMART
low complexity region 265 290 N/A INTRINSIC
RRM 296 365 1.84e-13 SMART
RRM 413 483 2.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165704
SMART Domains Protein: ENSMUSP00000127783
Gene: ENSMUSG00000006498

DomainStartEndE-ValueType
low complexity region 32 38 N/A INTRINSIC
RRM 59 128 9.8e-9 SMART
low complexity region 161 178 N/A INTRINSIC
RRM 184 253 4.75e-7 SMART
low complexity region 305 330 N/A INTRINSIC
RRM 336 405 1.84e-13 SMART
RRM 453 523 2.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165724
SMART Domains Protein: ENSMUSP00000130749
Gene: ENSMUSG00000006498

DomainStartEndE-ValueType
Pfam:RRM_5 2 40 5.3e-7 PFAM
low complexity region 114 139 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167250
SMART Domains Protein: ENSMUSP00000130695
Gene: ENSMUSG00000035835

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
acidPPc 132 276 1.38e-16 SMART
low complexity region 437 454 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168683
SMART Domains Protein: ENSMUSP00000132383
Gene: ENSMUSG00000006498

DomainStartEndE-ValueType
low complexity region 2 8 N/A INTRINSIC
SCOP:d2u1a__ 17 55 3e-3 SMART
PDB:2AD9|A 18 55 9e-19 PDB
Blast:RRM 29 55 2e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000169091
SMART Domains Protein: ENSMUSP00000128449
Gene: ENSMUSG00000006498

DomainStartEndE-ValueType
low complexity region 13 19 N/A INTRINSIC
Pfam:RRM_5 29 81 3.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169483
SMART Domains Protein: ENSMUSP00000127507
Gene: ENSMUSG00000006498

DomainStartEndE-ValueType
low complexity region 32 38 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000171599
AA Change: M20V
SMART Domains Protein: ENSMUSP00000131296
Gene: ENSMUSG00000006498
AA Change: M20V

DomainStartEndE-ValueType
low complexity region 87 93 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172282
SMART Domains Protein: ENSMUSP00000126192
Gene: ENSMUSG00000006498

DomainStartEndE-ValueType
low complexity region 32 38 N/A INTRINSIC
RRM 59 128 9.8e-9 SMART
low complexity region 161 178 N/A INTRINSIC
RRM 184 253 4.75e-7 SMART
low complexity region 331 356 N/A INTRINSIC
RRM 362 431 1.84e-13 SMART
RRM 479 549 2.6e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA-binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has four repeats of quasi-RNA recognition motif (RRM) domains that bind RNAs. This protein binds to the intronic polypyrimidine tracts that requires pre-mRNA splicing and acts via the protein degradation ubiquitin-proteasome pathway. It may also promote the binding of U2 snRNP to pre-mRNAs. This protein is localized in the nucleoplasm and it is also detected in the perinucleolar structure. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele die before E6.5. Mice homozygous for a conditional allele activated in neuronal stem cells (NSCs) exhibit premature death, and non-obstructive hydrocephaly with loss of ependymal cells due to precocious NSC differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A T 6: 48,931,128 Y354F probably damaging Het
1700001J03Rik A T 5: 146,184,867 I74N probably damaging Het
4921501E09Rik A G 17: 33,067,127 Y234H probably damaging Het
Abca6 A T 11: 110,241,653 V272D possibly damaging Het
Acot11 A T 4: 106,762,493 S163R probably benign Het
Adcy5 T C 16: 35,156,835 L246P probably damaging Het
Adgra1 A T 7: 139,847,657 probably null Het
Adgra2 A G 8: 27,122,027 T1335A probably damaging Het
Armt1 T C 10: 4,453,475 S187P probably damaging Het
Azin1 T C 15: 38,501,505 M1V probably null Het
B430305J03Rik C T 3: 61,363,835 C163Y unknown Het
Cables1 T C 18: 11,840,007 S68P possibly damaging Het
Cacna1d A G 14: 30,178,706 F341L probably benign Het
Ccdc90b T A 7: 92,572,568 H118Q probably damaging Het
Celf1 T A 2: 91,003,257 C119* probably null Het
Cfap57 C T 4: 118,593,096 V610M possibly damaging Het
Chrm4 T A 2: 91,927,250 M1K probably null Het
Chrnd C T 1: 87,197,479 T418I probably damaging Het
Coch G T 12: 51,593,561 probably benign Het
Cop1 A G 1: 159,284,548 T345A probably benign Het
Cops6 A G 5: 138,163,580 T96A probably benign Het
Corin T C 5: 72,305,055 I945V probably benign Het
Cyp2c67 G T 19: 39,617,339 T371N probably benign Het
Dap T A 15: 31,273,308 *103R probably null Het
Defb35 T A 8: 21,940,757 V49E unknown Het
Dmtf1 T A 5: 9,149,016 D39V possibly damaging Het
Dmtn T C 14: 70,618,020 T10A probably damaging Het
Dnajc1 C T 2: 18,293,972 E264K probably benign Het
Dtx3l A T 16: 35,933,401 N278K possibly damaging Het
Fam161a T A 11: 23,020,037 S72T possibly damaging Het
Fnbp4 T A 2: 90,745,796 S114T unknown Het
Focad T G 4: 88,309,906 I784S unknown Het
Fzd8 A T 18: 9,214,171 T418S probably damaging Het
Gclc A G 9: 77,785,371 Y264C probably benign Het
Ggn G A 7: 29,173,034 C649Y possibly damaging Het
Gm10184 G A 17: 89,910,135 T61I probably benign Het
Gys1 A G 7: 45,439,668 probably null Het
Hsd3b1 T C 3: 98,853,210 Y155C probably damaging Het
Htatip2 A G 7: 49,772,606 K191E probably benign Het
Ik A T 18: 36,748,222 S79C probably null Het
Kin G A 2: 10,091,793 R151Q probably benign Het
Mast4 A G 13: 102,738,478 S1461P probably damaging Het
Melk T A 4: 44,360,885 V555E probably damaging Het
Met G A 6: 17,491,317 C26Y probably damaging Het
Mfsd6 A T 1: 52,709,474 F77L probably damaging Het
Mib1 T A 18: 10,741,011 D86E probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Olfr1120 G A 2: 87,358,082 V213I probably benign Het
Olfr1352 A T 10: 78,984,497 K236* probably null Het
Olfr504 T G 7: 108,565,712 S28R probably benign Het
Olfr935 A G 9: 38,995,141 I98T probably benign Het
Patj A T 4: 98,591,933 I1296L probably benign Het
Pcdh1 C T 18: 38,203,217 V122M probably benign Het
Pcdhac2 A T 18: 37,144,893 I309F possibly damaging Het
Phtf1 A G 3: 103,998,696 S565G probably damaging Het
Plekha2 A C 8: 25,088,395 F30V probably damaging Het
Pth2r A G 1: 65,388,620 D484G probably benign Het
Rapgef2 G A 3: 79,087,903 Q665* probably null Het
Scamp1 G A 13: 94,233,140 T59I probably benign Het
Sema4a T A 3: 88,450,109 D230V probably damaging Het
Snw1 C T 12: 87,468,645 G45R possibly damaging Het
Sox30 T A 11: 45,984,520 probably null Het
Sspo T A 6: 48,473,952 I2665K probably benign Het
Stx5a T A 19: 8,755,277 W437R unknown Het
Tln1 A G 4: 43,542,602 V1402A probably benign Het
Tpm1 A G 9: 67,028,101 L244P probably benign Het
Try5 T A 6: 41,313,454 E32V probably benign Het
Ttn T C 2: 76,721,729 N31188S probably benign Het
Tulp1 T C 17: 28,363,405 probably null Het
Usp13 T G 3: 32,865,743 probably null Het
Vax2 A G 6: 83,711,316 E7G possibly damaging Het
Vmn2r45 A T 7: 8,485,613 Y139* probably null Het
Wisp2 T C 2: 163,828,852 F93S probably benign Het
Zfp423 T C 8: 87,904,527 D21G probably benign Het
Other mutations in Ptbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01115:Ptbp1 APN 10 79859962 splice site probably benign
IGL01335:Ptbp1 APN 10 79862874 splice site probably null
IGL03119:Ptbp1 APN 10 79859624 missense probably damaging 1.00
R1433:Ptbp1 UTSW 10 79863273 missense probably damaging 1.00
R2418:Ptbp1 UTSW 10 79859677 missense probably damaging 0.98
R4222:Ptbp1 UTSW 10 79859213 missense probably benign 0.07
R4223:Ptbp1 UTSW 10 79859213 missense probably benign 0.07
R4224:Ptbp1 UTSW 10 79859213 missense probably benign 0.07
R4688:Ptbp1 UTSW 10 79856508 missense possibly damaging 0.87
R5841:Ptbp1 UTSW 10 79859932 missense probably benign 0.31
R6961:Ptbp1 UTSW 10 79859277 splice site probably null
Predicted Primers PCR Primer
(F):5'- CATCAGGAAGCACTGTCTTGG -3'
(R):5'- ATGGGGTACAATGCCAAGC -3'

Sequencing Primer
(F):5'- AAGCACTGTCTTGGGCTGC -3'
(R):5'- GCTAGAGACACCTACCTTTGTACCG -3'
Posted On2019-06-26