Incidental Mutation 'R7242:Fam161a'
ID563302
Institutional Source Beutler Lab
Gene Symbol Fam161a
Ensembl Gene ENSMUSG00000049811
Gene Namefamily with sequence similarity 161, member A
Synonyms4930430E16Rik
MMRRC Submission
Accession Numbers

Genbank: NM_028672; MGI: 1921123

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7242 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location23007531-23030788 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 23020037 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 72 (S72T)
Ref Sequence ENSEMBL: ENSMUSP00000133293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058269] [ENSMUST00000109557] [ENSMUST00000151877] [ENSMUST00000172602] [ENSMUST00000173923]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058269
AA Change: S72T

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000063091
Gene: ENSMUSG00000049811
AA Change: S72T

DomainStartEndE-ValueType
coiled coil region 11 37 N/A INTRINSIC
low complexity region 54 67 N/A INTRINSIC
low complexity region 80 95 N/A INTRINSIC
Pfam:UPF0564 150 401 4.7e-74 PFAM
Pfam:UPF0564 398 451 5.8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094363
SMART Domains Protein: ENSMUSP00000091923
Gene: ENSMUSG00000049811

DomainStartEndE-ValueType
Pfam:UPF0564 1 136 3.6e-15 PFAM
low complexity region 181 202 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109557
AA Change: S72T

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105184
Gene: ENSMUSG00000049811
AA Change: S72T

DomainStartEndE-ValueType
coiled coil region 11 37 N/A INTRINSIC
low complexity region 54 67 N/A INTRINSIC
low complexity region 80 95 N/A INTRINSIC
Pfam:UPF0564 150 350 8.1e-36 PFAM
low complexity region 396 417 N/A INTRINSIC
coiled coil region 437 460 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151877
SMART Domains Protein: ENSMUSP00000121167
Gene: ENSMUSG00000049811

DomainStartEndE-ValueType
Pfam:UPF0564 1 263 2.2e-41 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000172602
AA Change: S72T

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134485
Gene: ENSMUSG00000049811
AA Change: S72T

DomainStartEndE-ValueType
coiled coil region 11 37 N/A INTRINSIC
low complexity region 54 67 N/A INTRINSIC
low complexity region 80 95 N/A INTRINSIC
Pfam:UPF0564 150 401 4.7e-74 PFAM
Pfam:UPF0564 398 451 5.8e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000173923
AA Change: S72T

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000133293
Gene: ENSMUSG00000049811
AA Change: S72T

DomainStartEndE-ValueType
coiled coil region 11 37 N/A INTRINSIC
low complexity region 54 67 N/A INTRINSIC
low complexity region 80 95 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the FAM161 family. It is expressed mainly in the retina. Mouse studies suggested that this gene is involved in development of retinal progenitors during embryogenesis, and that its activity is restricted to mature photoreceptors after birth. Mutations in this gene cause autosomal recessive retinitis pigmentosa-28. Alternatively spliced transcript variants have been identified.[provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele show early loss of visual function associated with alterations in photoreceptor ciliary structure, abnormal photoreceptor outer segment morphology, microgliosis, and progressive retinal photoreceptor degeneration. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A T 6: 48,931,128 Y354F probably damaging Het
1700001J03Rik A T 5: 146,184,867 I74N probably damaging Het
4921501E09Rik A G 17: 33,067,127 Y234H probably damaging Het
Abca6 A T 11: 110,241,653 V272D possibly damaging Het
Acot11 A T 4: 106,762,493 S163R probably benign Het
Adcy5 T C 16: 35,156,835 L246P probably damaging Het
Adgra1 A T 7: 139,847,657 probably null Het
Adgra2 A G 8: 27,122,027 T1335A probably damaging Het
Armt1 T C 10: 4,453,475 S187P probably damaging Het
Azin1 T C 15: 38,501,505 M1V probably null Het
B430305J03Rik C T 3: 61,363,835 C163Y unknown Het
Cables1 T C 18: 11,840,007 S68P possibly damaging Het
Cacna1d A G 14: 30,178,706 F341L probably benign Het
Ccdc90b T A 7: 92,572,568 H118Q probably damaging Het
Celf1 T A 2: 91,003,257 C119* probably null Het
Cfap57 C T 4: 118,593,096 V610M possibly damaging Het
Chrm4 T A 2: 91,927,250 M1K probably null Het
Chrnd C T 1: 87,197,479 T418I probably damaging Het
Coch G T 12: 51,593,561 probably benign Het
Cop1 A G 1: 159,284,548 T345A probably benign Het
Cops6 A G 5: 138,163,580 T96A probably benign Het
Corin T C 5: 72,305,055 I945V probably benign Het
Cyp2c67 G T 19: 39,617,339 T371N probably benign Het
Dap T A 15: 31,273,308 *103R probably null Het
Defb35 T A 8: 21,940,757 V49E unknown Het
Dmtf1 T A 5: 9,149,016 D39V possibly damaging Het
Dmtn T C 14: 70,618,020 T10A probably damaging Het
Dnajc1 C T 2: 18,293,972 E264K probably benign Het
Dtx3l A T 16: 35,933,401 N278K possibly damaging Het
Fnbp4 T A 2: 90,745,796 S114T unknown Het
Focad T G 4: 88,309,906 I784S unknown Het
Fzd8 A T 18: 9,214,171 T418S probably damaging Het
Gclc A G 9: 77,785,371 Y264C probably benign Het
Ggn G A 7: 29,173,034 C649Y possibly damaging Het
Gm10184 G A 17: 89,910,135 T61I probably benign Het
Gys1 A G 7: 45,439,668 probably null Het
Hsd3b1 T C 3: 98,853,210 Y155C probably damaging Het
Htatip2 A G 7: 49,772,606 K191E probably benign Het
Ik A T 18: 36,748,222 S79C probably null Het
Kin G A 2: 10,091,793 R151Q probably benign Het
Mast4 A G 13: 102,738,478 S1461P probably damaging Het
Melk T A 4: 44,360,885 V555E probably damaging Het
Met G A 6: 17,491,317 C26Y probably damaging Het
Mfsd6 A T 1: 52,709,474 F77L probably damaging Het
Mib1 T A 18: 10,741,011 D86E probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Olfr1120 G A 2: 87,358,082 V213I probably benign Het
Olfr1352 A T 10: 78,984,497 K236* probably null Het
Olfr504 T G 7: 108,565,712 S28R probably benign Het
Olfr935 A G 9: 38,995,141 I98T probably benign Het
Patj A T 4: 98,591,933 I1296L probably benign Het
Pcdh1 C T 18: 38,203,217 V122M probably benign Het
Pcdhac2 A T 18: 37,144,893 I309F possibly damaging Het
Phtf1 A G 3: 103,998,696 S565G probably damaging Het
Plekha2 A C 8: 25,088,395 F30V probably damaging Het
Ptbp1 A G 10: 79,856,388 M20V unknown Het
Pth2r A G 1: 65,388,620 D484G probably benign Het
Rapgef2 G A 3: 79,087,903 Q665* probably null Het
Scamp1 G A 13: 94,233,140 T59I probably benign Het
Sema4a T A 3: 88,450,109 D230V probably damaging Het
Snw1 C T 12: 87,468,645 G45R possibly damaging Het
Sox30 T A 11: 45,984,520 probably null Het
Sspo T A 6: 48,473,952 I2665K probably benign Het
Stx5a T A 19: 8,755,277 W437R unknown Het
Tln1 A G 4: 43,542,602 V1402A probably benign Het
Tpm1 A G 9: 67,028,101 L244P probably benign Het
Try5 T A 6: 41,313,454 E32V probably benign Het
Ttn T C 2: 76,721,729 N31188S probably benign Het
Tulp1 T C 17: 28,363,405 probably null Het
Usp13 T G 3: 32,865,743 probably null Het
Vax2 A G 6: 83,711,316 E7G possibly damaging Het
Vmn2r45 A T 7: 8,485,613 Y139* probably null Het
Wisp2 T C 2: 163,828,852 F93S probably benign Het
Zfp423 T C 8: 87,904,527 D21G probably benign Het
Other mutations in Fam161a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Fam161a APN 11 23015894 unclassified probably benign
IGL01457:Fam161a APN 11 23020702 nonsense probably null
IGL01823:Fam161a APN 11 23015785 missense probably damaging 1.00
IGL02111:Fam161a APN 11 23020026 missense probably benign 0.05
3-1:Fam161a UTSW 11 23023429 critical splice acceptor site probably null
R0531:Fam161a UTSW 11 23020298 missense possibly damaging 0.49
R1524:Fam161a UTSW 11 23015826 missense possibly damaging 0.80
R1550:Fam161a UTSW 11 23020470 missense possibly damaging 0.58
R1599:Fam161a UTSW 11 23021093 missense probably benign 0.43
R3744:Fam161a UTSW 11 23020410 missense probably damaging 1.00
R3962:Fam161a UTSW 11 23023507 missense possibly damaging 0.82
R4352:Fam161a UTSW 11 23020798 missense possibly damaging 0.90
R4607:Fam161a UTSW 11 23020710 missense probably benign 0.03
R4820:Fam161a UTSW 11 23020076 missense probably damaging 1.00
R5057:Fam161a UTSW 11 23020397 missense probably damaging 1.00
R5207:Fam161a UTSW 11 23020583 nonsense probably null
R5645:Fam161a UTSW 11 23015725 missense probably damaging 1.00
R5705:Fam161a UTSW 11 23028869 missense unknown
R7107:Fam161a UTSW 11 23023452 missense possibly damaging 0.84
R7203:Fam161a UTSW 11 23021664 splice site probably null
R7286:Fam161a UTSW 11 23020001 missense possibly damaging 0.58
R7483:Fam161a UTSW 11 23021006 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATTGTCACGACCCTTAGACAGC -3'
(R):5'- GGTGTCAAGGATTTAGCTTTCTTCC -3'

Sequencing Primer
(F):5'- AGACAGCTACTCCCTTCTGG -3'
(R):5'- CTGTTCGGGAGTCTGAGTCATAC -3'
Posted On2019-06-26