Incidental Mutation 'R7242:Snw1'
ID563305
Institutional Source Beutler Lab
Gene Symbol Snw1
Ensembl Gene ENSMUSG00000021039
Gene NameSNW domain containing 1
SynonymsSkiip, SKIP, NCoA-62, 2310008B08Rik, SNW1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R7242 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location87449075-87472274 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 87468645 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 45 (G45R)
Ref Sequence ENSEMBL: ENSMUSP00000021428 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021428]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021428
AA Change: G45R

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000021428
Gene: ENSMUSG00000021039
AA Change: G45R

DomainStartEndE-ValueType
Pfam:SKIP_SNW 175 335 2e-78 PFAM
low complexity region 524 536 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a member of the SNW gene family, encodes a coactivator that enhances transcription from some Pol II promoters. This coactivator can bind to the ligand-binding domain of the vitamin D receptor and to retinoid receptors to enhance vitamin D-, retinoic acid-, estrogen-, and glucocorticoid-mediated gene expression. It can also function as a splicing factor by interacting with poly(A)-binding protein 2 to directly control the expression of muscle-specific genes at the transcriptional level. Finally, the protein may be involved in oncogenesis since it interacts with a region of SKI oncoproteins that is required for transforming activity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A T 6: 48,931,128 Y354F probably damaging Het
1700001J03Rik A T 5: 146,184,867 I74N probably damaging Het
4921501E09Rik A G 17: 33,067,127 Y234H probably damaging Het
Abca6 A T 11: 110,241,653 V272D possibly damaging Het
Acot11 A T 4: 106,762,493 S163R probably benign Het
Adcy5 T C 16: 35,156,835 L246P probably damaging Het
Adgra1 A T 7: 139,847,657 probably null Het
Adgra2 A G 8: 27,122,027 T1335A probably damaging Het
Armt1 T C 10: 4,453,475 S187P probably damaging Het
Azin1 T C 15: 38,501,505 M1V probably null Het
B430305J03Rik C T 3: 61,363,835 C163Y unknown Het
Cacna1d A G 14: 30,178,706 F341L probably benign Het
Ccdc90b T A 7: 92,572,568 H118Q probably damaging Het
Celf1 T A 2: 91,003,257 C119* probably null Het
Cfap57 C T 4: 118,593,096 V610M possibly damaging Het
Chrm4 T A 2: 91,927,250 M1K probably null Het
Chrnd C T 1: 87,197,479 T418I probably damaging Het
Coch G T 12: 51,593,561 probably benign Het
Cop1 A G 1: 159,284,548 T345A probably benign Het
Cops6 A G 5: 138,163,580 T96A probably benign Het
Corin T C 5: 72,305,055 I945V probably benign Het
Cyp2c67 G T 19: 39,617,339 T371N probably benign Het
Dap T A 15: 31,273,308 *103R probably null Het
Defb35 T A 8: 21,940,757 V49E unknown Het
Dmtf1 T A 5: 9,149,016 D39V possibly damaging Het
Dmtn T C 14: 70,618,020 T10A probably damaging Het
Dnajc1 C T 2: 18,293,972 E264K probably benign Het
Dtx3l A T 16: 35,933,401 N278K possibly damaging Het
Fam161a T A 11: 23,020,037 S72T possibly damaging Het
Fnbp4 T A 2: 90,745,796 S114T unknown Het
Focad T G 4: 88,309,906 I784S unknown Het
Fzd8 A T 18: 9,214,171 T418S probably damaging Het
Gclc A G 9: 77,785,371 Y264C probably benign Het
Ggn G A 7: 29,173,034 C649Y possibly damaging Het
Gm10184 G A 17: 89,910,135 T61I probably benign Het
Hsd3b1 T C 3: 98,853,210 Y155C probably damaging Het
Htatip2 A G 7: 49,772,606 K191E probably benign Het
Ik A T 18: 36,748,222 S79C probably null Het
Kin G A 2: 10,091,793 R151Q probably benign Het
Mast4 A G 13: 102,738,478 S1461P probably damaging Het
Melk T A 4: 44,360,885 V555E probably damaging Het
Met G A 6: 17,491,317 C26Y probably damaging Het
Mfsd6 A T 1: 52,709,474 F77L probably damaging Het
Mib1 T A 18: 10,741,011 D86E probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Olfr1120 G A 2: 87,358,082 V213I probably benign Het
Olfr1352 A T 10: 78,984,497 K236* probably null Het
Olfr504 T G 7: 108,565,712 S28R probably benign Het
Olfr935 A G 9: 38,995,141 I98T probably benign Het
Patj A T 4: 98,591,933 I1296L probably benign Het
Pcdh1 C T 18: 38,203,217 V122M probably benign Het
Pcdhac2 A T 18: 37,144,893 I309F possibly damaging Het
Phtf1 A G 3: 103,998,696 S565G probably damaging Het
Plekha2 A C 8: 25,088,395 F30V probably damaging Het
Ptbp1 A G 10: 79,856,388 M20V unknown Het
Pth2r A G 1: 65,388,620 D484G probably benign Het
Rapgef2 G A 3: 79,087,903 Q665* probably null Het
Scamp1 G A 13: 94,233,140 T59I probably benign Het
Sema4a T A 3: 88,450,109 D230V probably damaging Het
Sspo T A 6: 48,473,952 I2665K probably benign Het
Stx5a T A 19: 8,755,277 W437R unknown Het
Tln1 A G 4: 43,542,602 V1402A probably benign Het
Tpm1 A G 9: 67,028,101 L244P probably benign Het
Try5 T A 6: 41,313,454 E32V probably benign Het
Ttn T C 2: 76,721,729 N31188S probably benign Het
Vax2 A G 6: 83,711,316 E7G possibly damaging Het
Vmn2r45 A T 7: 8,485,613 Y139* probably null Het
Wisp2 T C 2: 163,828,852 F93S probably benign Het
Zfp423 T C 8: 87,904,527 D21G probably benign Het
Other mutations in Snw1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Snw1 APN 12 87452580 critical splice donor site probably null
IGL00559:Snw1 APN 12 87468731 missense probably damaging 0.98
IGL00561:Snw1 APN 12 87450804 critical splice donor site probably null
IGL01019:Snw1 APN 12 87450941 missense probably benign 0.24
IGL01304:Snw1 APN 12 87453915 missense possibly damaging 0.71
IGL01918:Snw1 APN 12 87455668 missense probably benign 0.14
IGL03170:Snw1 APN 12 87472252 missense probably benign 0.00
R0149:Snw1 UTSW 12 87461917 missense possibly damaging 0.51
R1760:Snw1 UTSW 12 87464689 missense probably benign 0.06
R1935:Snw1 UTSW 12 87459477 missense probably damaging 1.00
R2130:Snw1 UTSW 12 87452703 unclassified probably benign
R2230:Snw1 UTSW 12 87452658 missense probably benign 0.00
R2496:Snw1 UTSW 12 87450819 missense probably benign
R4907:Snw1 UTSW 12 87459489 missense probably benign 0.19
R4926:Snw1 UTSW 12 87452658 missense probably benign 0.00
R5138:Snw1 UTSW 12 87460435 missense probably benign 0.00
R5447:Snw1 UTSW 12 87455715 missense probably benign 0.19
R6239:Snw1 UTSW 12 87464628 missense probably damaging 1.00
R6552:Snw1 UTSW 12 87459419 critical splice donor site probably null
R6747:Snw1 UTSW 12 87464710 missense probably damaging 1.00
R7230:Snw1 UTSW 12 87464554 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGCAAAACAGTGATTCTCCGG -3'
(R):5'- TCATTGAAAAGTCTGTGTGCAG -3'

Sequencing Primer
(F):5'- GCAAAACAGTGATTCTCCGGTGATC -3'
(R):5'- TCTGTGTGCAGAGTAAAGGC -3'
Posted On2019-06-26