Incidental Mutation 'R7242:Scamp1'
ID563306
Institutional Source Beutler Lab
Gene Symbol Scamp1
Ensembl Gene ENSMUSG00000021687
Gene Namesecretory carrier membrane protein 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7242 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location94201310-94285857 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 94233140 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 59 (T59I)
Ref Sequence ENSEMBL: ENSMUSP00000022197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022197] [ENSMUST00000138255] [ENSMUST00000152555] [ENSMUST00000153558]
Predicted Effect probably benign
Transcript: ENSMUST00000022197
AA Change: T59I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000022197
Gene: ENSMUSG00000021687
AA Change: T59I

DomainStartEndE-ValueType
coiled coil region 75 114 N/A INTRINSIC
Pfam:SCAMP 117 292 7.4e-74 PFAM
low complexity region 314 332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138255
AA Change: T7I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000121039
Gene: ENSMUSG00000021687
AA Change: T7I

DomainStartEndE-ValueType
coiled coil region 23 62 N/A INTRINSIC
Pfam:SCAMP 64 116 2.1e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152555
AA Change: T7I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000123135
Gene: ENSMUSG00000021687
AA Change: T7I

DomainStartEndE-ValueType
coiled coil region 23 62 N/A INTRINSIC
Pfam:SCAMP 64 241 2.3e-78 PFAM
low complexity region 262 280 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153558
AA Change: T7I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000120053
Gene: ENSMUSG00000021687
AA Change: T7I

DomainStartEndE-ValueType
coiled coil region 23 62 N/A INTRINSIC
Pfam:SCAMP 64 241 2.3e-78 PFAM
low complexity region 262 280 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the SCAMP family of proteins, which are secretory carrier membrane proteins. They function as carriers to the cell surface in post-golgi recycling pathways. Different family members are highly related products of distinct genes, and are usually expressed together. These findings suggest that these protein family members may function at the same site during vesicular transport rather than in separate pathways. A pseudogene of this gene has been defined on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation do not exhibit any overt abnormalities, but final cell capacitance of mast cells completing exocytosis was smaller than controls and an increased proportion of reversible fusion events was noted. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A T 6: 48,931,128 Y354F probably damaging Het
1700001J03Rik A T 5: 146,184,867 I74N probably damaging Het
4921501E09Rik A G 17: 33,067,127 Y234H probably damaging Het
Abca6 A T 11: 110,241,653 V272D possibly damaging Het
Acot11 A T 4: 106,762,493 S163R probably benign Het
Adcy5 T C 16: 35,156,835 L246P probably damaging Het
Adgra1 A T 7: 139,847,657 probably null Het
Adgra2 A G 8: 27,122,027 T1335A probably damaging Het
Armt1 T C 10: 4,453,475 S187P probably damaging Het
Azin1 T C 15: 38,501,505 M1V probably null Het
B430305J03Rik C T 3: 61,363,835 C163Y unknown Het
Cables1 T C 18: 11,840,007 S68P possibly damaging Het
Cacna1d A G 14: 30,178,706 F341L probably benign Het
Ccdc90b T A 7: 92,572,568 H118Q probably damaging Het
Celf1 T A 2: 91,003,257 C119* probably null Het
Cfap57 C T 4: 118,593,096 V610M possibly damaging Het
Chrm4 T A 2: 91,927,250 M1K probably null Het
Chrnd C T 1: 87,197,479 T418I probably damaging Het
Coch G T 12: 51,593,561 probably benign Het
Cop1 A G 1: 159,284,548 T345A probably benign Het
Cops6 A G 5: 138,163,580 T96A probably benign Het
Corin T C 5: 72,305,055 I945V probably benign Het
Cyp2c67 G T 19: 39,617,339 T371N probably benign Het
Dap T A 15: 31,273,308 *103R probably null Het
Defb35 T A 8: 21,940,757 V49E unknown Het
Dmtf1 T A 5: 9,149,016 D39V possibly damaging Het
Dmtn T C 14: 70,618,020 T10A probably damaging Het
Dnajc1 C T 2: 18,293,972 E264K probably benign Het
Dtx3l A T 16: 35,933,401 N278K possibly damaging Het
Fam161a T A 11: 23,020,037 S72T possibly damaging Het
Fnbp4 T A 2: 90,745,796 S114T unknown Het
Focad T G 4: 88,309,906 I784S unknown Het
Fzd8 A T 18: 9,214,171 T418S probably damaging Het
Gclc A G 9: 77,785,371 Y264C probably benign Het
Ggn G A 7: 29,173,034 C649Y possibly damaging Het
Gm10184 G A 17: 89,910,135 T61I probably benign Het
Gys1 A G 7: 45,439,668 probably null Het
Hsd3b1 T C 3: 98,853,210 Y155C probably damaging Het
Htatip2 A G 7: 49,772,606 K191E probably benign Het
Ik A T 18: 36,748,222 S79C probably null Het
Kin G A 2: 10,091,793 R151Q probably benign Het
Mast4 A G 13: 102,738,478 S1461P probably damaging Het
Melk T A 4: 44,360,885 V555E probably damaging Het
Met G A 6: 17,491,317 C26Y probably damaging Het
Mfsd6 A T 1: 52,709,474 F77L probably damaging Het
Mib1 T A 18: 10,741,011 D86E probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Olfr1120 G A 2: 87,358,082 V213I probably benign Het
Olfr1352 A T 10: 78,984,497 K236* probably null Het
Olfr504 T G 7: 108,565,712 S28R probably benign Het
Olfr935 A G 9: 38,995,141 I98T probably benign Het
Patj A T 4: 98,591,933 I1296L probably benign Het
Pcdh1 C T 18: 38,203,217 V122M probably benign Het
Pcdhac2 A T 18: 37,144,893 I309F possibly damaging Het
Phtf1 A G 3: 103,998,696 S565G probably damaging Het
Plekha2 A C 8: 25,088,395 F30V probably damaging Het
Ptbp1 A G 10: 79,856,388 M20V unknown Het
Pth2r A G 1: 65,388,620 D484G probably benign Het
Rapgef2 G A 3: 79,087,903 Q665* probably null Het
Sema4a T A 3: 88,450,109 D230V probably damaging Het
Snw1 C T 12: 87,468,645 G45R possibly damaging Het
Sox30 T A 11: 45,984,520 probably null Het
Sspo T A 6: 48,473,952 I2665K probably benign Het
Stx5a T A 19: 8,755,277 W437R unknown Het
Tln1 A G 4: 43,542,602 V1402A probably benign Het
Tpm1 A G 9: 67,028,101 L244P probably benign Het
Try5 T A 6: 41,313,454 E32V probably benign Het
Ttn T C 2: 76,721,729 N31188S probably benign Het
Tulp1 T C 17: 28,363,405 probably null Het
Usp13 T G 3: 32,865,743 probably null Het
Vax2 A G 6: 83,711,316 E7G possibly damaging Het
Vmn2r45 A T 7: 8,485,613 Y139* probably null Het
Wisp2 T C 2: 163,828,852 F93S probably benign Het
Zfp423 T C 8: 87,904,527 D21G probably benign Het
Other mutations in Scamp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01447:Scamp1 APN 13 94204022 missense probably damaging 1.00
IGL02269:Scamp1 APN 13 94232186 splice site probably benign
R0067:Scamp1 UTSW 13 94204150 missense probably damaging 1.00
R0067:Scamp1 UTSW 13 94204150 missense probably damaging 1.00
R0254:Scamp1 UTSW 13 94210580 missense probably benign 0.00
R0367:Scamp1 UTSW 13 94210580 missense probably benign 0.01
R0559:Scamp1 UTSW 13 94208182 missense possibly damaging 0.79
R1147:Scamp1 UTSW 13 94224886 unclassified probably null
R1400:Scamp1 UTSW 13 94224947 missense possibly damaging 0.53
R1499:Scamp1 UTSW 13 94224929 missense probably benign 0.03
R5206:Scamp1 UTSW 13 94232107 missense probably damaging 1.00
R5259:Scamp1 UTSW 13 94232086 missense probably benign
R5300:Scamp1 UTSW 13 94204162 missense probably damaging 0.99
R6128:Scamp1 UTSW 13 94208227 missense possibly damaging 0.80
R7017:Scamp1 UTSW 13 94224915 missense probably damaging 0.98
R7219:Scamp1 UTSW 13 94224907 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTCGTTACTGTAGAGCATTATCC -3'
(R):5'- TTTACATGGGGTACTGCTCAGC -3'

Sequencing Primer
(F):5'- GTAGAGCATTATCCATTGGCACC -3'
(R):5'- CTCAGCGTTGTAAAACTGAGACTCG -3'
Posted On2019-06-26