Incidental Mutation 'R7242:Dtx3l'
ID563313
Institutional Source Beutler Lab
Gene Symbol Dtx3l
Ensembl Gene ENSMUSG00000049502
Gene Namedeltex 3-like, E3 ubiquitin ligase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.350) question?
Stock #R7242 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location35926511-35939151 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 35933401 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 278 (N278K)
Ref Sequence ENSEMBL: ENSMUSP00000080601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081933] [ENSMUST00000114885]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081933
AA Change: N278K

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000080601
Gene: ENSMUSG00000049502
AA Change: N278K

DomainStartEndE-ValueType
low complexity region 54 69 N/A INTRINSIC
RING 569 607 5.82e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114885
AA Change: N278K

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110535
Gene: ENSMUSG00000049502
AA Change: N278K

DomainStartEndE-ValueType
low complexity region 54 69 N/A INTRINSIC
RING 569 607 5.82e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DTX3L functions as an E3 ubiquitin ligase (Takeyama et al., 2003 [PubMed 12670957]).[supplied by OMIM, Nov 2009]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A T 6: 48,931,128 Y354F probably damaging Het
1700001J03Rik A T 5: 146,184,867 I74N probably damaging Het
4921501E09Rik A G 17: 33,067,127 Y234H probably damaging Het
Abca6 A T 11: 110,241,653 V272D possibly damaging Het
Acot11 A T 4: 106,762,493 S163R probably benign Het
Adcy5 T C 16: 35,156,835 L246P probably damaging Het
Adgra1 A T 7: 139,847,657 probably null Het
Adgra2 A G 8: 27,122,027 T1335A probably damaging Het
Armt1 T C 10: 4,453,475 S187P probably damaging Het
Azin1 T C 15: 38,501,505 M1V probably null Het
B430305J03Rik C T 3: 61,363,835 C163Y unknown Het
Cables1 T C 18: 11,840,007 S68P possibly damaging Het
Cacna1d A G 14: 30,178,706 F341L probably benign Het
Ccdc90b T A 7: 92,572,568 H118Q probably damaging Het
Celf1 T A 2: 91,003,257 C119* probably null Het
Cfap57 C T 4: 118,593,096 V610M possibly damaging Het
Chrm4 T A 2: 91,927,250 M1K probably null Het
Chrnd C T 1: 87,197,479 T418I probably damaging Het
Coch G T 12: 51,593,561 probably benign Het
Cop1 A G 1: 159,284,548 T345A probably benign Het
Cops6 A G 5: 138,163,580 T96A probably benign Het
Corin T C 5: 72,305,055 I945V probably benign Het
Cyp2c67 G T 19: 39,617,339 T371N probably benign Het
Dap T A 15: 31,273,308 *103R probably null Het
Defb35 T A 8: 21,940,757 V49E unknown Het
Dmtf1 T A 5: 9,149,016 D39V possibly damaging Het
Dmtn T C 14: 70,618,020 T10A probably damaging Het
Dnajc1 C T 2: 18,293,972 E264K probably benign Het
Fam161a T A 11: 23,020,037 S72T possibly damaging Het
Fnbp4 T A 2: 90,745,796 S114T unknown Het
Focad T G 4: 88,309,906 I784S unknown Het
Fzd8 A T 18: 9,214,171 T418S probably damaging Het
Gclc A G 9: 77,785,371 Y264C probably benign Het
Ggn G A 7: 29,173,034 C649Y possibly damaging Het
Gm10184 G A 17: 89,910,135 T61I probably benign Het
Gys1 A G 7: 45,439,668 probably null Het
Hsd3b1 T C 3: 98,853,210 Y155C probably damaging Het
Htatip2 A G 7: 49,772,606 K191E probably benign Het
Ik A T 18: 36,748,222 S79C probably null Het
Kin G A 2: 10,091,793 R151Q probably benign Het
Mast4 A G 13: 102,738,478 S1461P probably damaging Het
Melk T A 4: 44,360,885 V555E probably damaging Het
Met G A 6: 17,491,317 C26Y probably damaging Het
Mfsd6 A T 1: 52,709,474 F77L probably damaging Het
Mib1 T A 18: 10,741,011 D86E probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Olfr1120 G A 2: 87,358,082 V213I probably benign Het
Olfr1352 A T 10: 78,984,497 K236* probably null Het
Olfr504 T G 7: 108,565,712 S28R probably benign Het
Olfr935 A G 9: 38,995,141 I98T probably benign Het
Patj A T 4: 98,591,933 I1296L probably benign Het
Pcdh1 C T 18: 38,203,217 V122M probably benign Het
Pcdhac2 A T 18: 37,144,893 I309F possibly damaging Het
Phtf1 A G 3: 103,998,696 S565G probably damaging Het
Plekha2 A C 8: 25,088,395 F30V probably damaging Het
Ptbp1 A G 10: 79,856,388 M20V unknown Het
Pth2r A G 1: 65,388,620 D484G probably benign Het
Rapgef2 G A 3: 79,087,903 Q665* probably null Het
Scamp1 G A 13: 94,233,140 T59I probably benign Het
Sema4a T A 3: 88,450,109 D230V probably damaging Het
Snw1 C T 12: 87,468,645 G45R possibly damaging Het
Sox30 T A 11: 45,984,520 probably null Het
Sspo T A 6: 48,473,952 I2665K probably benign Het
Stx5a T A 19: 8,755,277 W437R unknown Het
Tln1 A G 4: 43,542,602 V1402A probably benign Het
Tpm1 A G 9: 67,028,101 L244P probably benign Het
Try5 T A 6: 41,313,454 E32V probably benign Het
Ttn T C 2: 76,721,729 N31188S probably benign Het
Tulp1 T C 17: 28,363,405 probably null Het
Usp13 T G 3: 32,865,743 probably null Het
Vax2 A G 6: 83,711,316 E7G possibly damaging Het
Vmn2r45 A T 7: 8,485,613 Y139* probably null Het
Wisp2 T C 2: 163,828,852 F93S probably benign Het
Zfp423 T C 8: 87,904,527 D21G probably benign Het
Other mutations in Dtx3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01814:Dtx3l APN 16 35931502 missense probably benign 0.10
IGL02255:Dtx3l APN 16 35933336 missense probably benign 0.10
R0560:Dtx3l UTSW 16 35932935 missense probably damaging 1.00
R1123:Dtx3l UTSW 16 35933268 missense probably damaging 1.00
R1127:Dtx3l UTSW 16 35938757 missense possibly damaging 0.74
R1466:Dtx3l UTSW 16 35932728 missense probably damaging 1.00
R1466:Dtx3l UTSW 16 35932728 missense probably damaging 1.00
R1584:Dtx3l UTSW 16 35932728 missense probably damaging 1.00
R1690:Dtx3l UTSW 16 35933268 missense probably damaging 1.00
R1929:Dtx3l UTSW 16 35933689 missense possibly damaging 0.95
R2014:Dtx3l UTSW 16 35936427 missense probably benign 0.08
R2015:Dtx3l UTSW 16 35936427 missense probably benign 0.08
R2255:Dtx3l UTSW 16 35936579 missense probably benign 0.01
R3023:Dtx3l UTSW 16 35932436 missense probably benign 0.01
R3176:Dtx3l UTSW 16 35932173 missense probably benign 0.29
R5224:Dtx3l UTSW 16 35938793 missense possibly damaging 0.93
R5233:Dtx3l UTSW 16 35933238 missense possibly damaging 0.49
R5375:Dtx3l UTSW 16 35933027 missense probably damaging 1.00
R5884:Dtx3l UTSW 16 35932233 missense probably benign
R6821:Dtx3l UTSW 16 35933060 missense probably damaging 1.00
R6994:Dtx3l UTSW 16 35931372 critical splice donor site probably null
R7270:Dtx3l UTSW 16 35933657 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGGGAAGCAGCGACTCAG -3'
(R):5'- TGAGTGAGCAGCTTTTGGAACG -3'

Sequencing Primer
(F):5'- AGCGACTCAGCTCCTGTCTG -3'
(R):5'- CAGCTTTTGGAACGGGAGC -3'
Posted On2019-06-26