Incidental Mutation 'R7243:Aox3'
ID563325
Institutional Source Beutler Lab
Gene Symbol Aox3
Ensembl Gene ENSMUSG00000064294
Gene Namealdehyde oxidase 3
SynonymsAOH1, 1200011D03Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7243 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location58113130-58200698 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 58138307 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 227 (G227V)
Ref Sequence ENSEMBL: ENSMUSP00000140140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040999] [ENSMUST00000162011]
Predicted Effect probably benign
Transcript: ENSMUST00000040999
SMART Domains Protein: ENSMUSP00000049391
Gene: ENSMUSG00000064294

DomainStartEndE-ValueType
Pfam:Fer2 12 82 1.4e-9 PFAM
Pfam:Fer2_2 91 165 1e-29 PFAM
Pfam:FAD_binding_5 239 419 1e-44 PFAM
CO_deh_flav_C 426 530 9.26e-24 SMART
Ald_Xan_dh_C 594 697 2.27e-41 SMART
Pfam:Ald_Xan_dh_C2 708 1241 8.7e-183 PFAM
low complexity region 1275 1286 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000162011
AA Change: G227V
SMART Domains Protein: ENSMUSP00000140140
Gene: ENSMUSG00000064294
AA Change: G227V

DomainStartEndE-ValueType
Pfam:Fer2 12 82 3.6e-8 PFAM
Pfam:Fer2_2 91 166 2.5e-29 PFAM
transmembrane domain 242 264 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A G 9: 92,343,673 Y16C probably damaging Het
Acap1 G A 11: 69,890,471 H103Y probably benign Het
Adamdec1 A G 14: 68,571,754 M253T probably benign Het
Alox15 C A 11: 70,350,714 G114C probably null Het
Atp8a2 A T 14: 59,647,842 N1144K probably benign Het
Cacna1c C T 6: 118,637,729 probably null Het
Cog6 A T 3: 53,002,315 W314R probably damaging Het
Col5a2 A G 1: 45,376,160 I1473T probably benign Het
Csmd1 T A 8: 15,915,357 D3218V probably damaging Het
Cyp3a11 A G 5: 145,858,803 M446T probably damaging Het
Dhps A G 8: 85,074,938 Y340C probably benign Het
Dnah7b A G 1: 46,083,754 N108S probably benign Het
Dnajb1 C T 8: 83,610,764 P323L probably damaging Het
Dspp TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG 5: 104,178,361 probably benign Het
Dync2h1 G T 9: 7,102,405 T2665K possibly damaging Het
Etv1 C T 12: 38,857,046 S349L probably benign Het
Fam171a1 A T 2: 3,118,616 T21S probably benign Het
Fbxo18 T A 2: 11,751,525 T749S probably benign Het
Fcho2 T C 13: 98,755,216 D346G possibly damaging Het
Fcrl5 A G 3: 87,442,245 H109R probably benign Het
Fstl1 A G 16: 37,826,726 S153G probably benign Het
Fyb T C 15: 6,643,699 F605L probably benign Het
Gcat T A 15: 79,036,863 M363K possibly damaging Het
Gm10604 T C 4: 11,980,113 T64A unknown Het
Grin2d A G 7: 45,866,128 L147P probably damaging Het
Ift88 A T 14: 57,430,536 probably null Het
Ighg1 A T 12: 113,330,446 C26S Het
Ing2 A G 8: 47,674,539 S48P probably damaging Het
Kat6a C T 8: 22,938,775 T1382I probably benign Het
Kdm1a A G 4: 136,551,954 V765A probably damaging Het
Klk1b26 T C 7: 44,016,267 S168P not run Het
Klk1b26 A G 7: 44,016,913 N260S probably damaging Het
Lama3 G A 18: 12,419,845 G438D probably damaging Het
Larp6 T A 9: 60,713,286 D27E probably benign Het
Megf9 T C 4: 70,435,471 E366G probably benign Het
Mob1b T A 5: 88,743,445 D52E probably damaging Het
Ndufb3 A T 1: 58,591,123 H11L unknown Het
Odc1 T G 12: 17,550,057 Y407* probably null Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr328 T C 11: 58,551,401 I279M probably damaging Het
Olfr401 T A 11: 74,121,733 V148E probably damaging Het
Olfr642 A G 7: 104,049,755 Y200H probably damaging Het
Opa1 A G 16: 29,586,996 I126M probably benign Het
Pcca A G 14: 122,876,774 H633R probably benign Het
Pcdhb22 A G 18: 37,520,632 R461G probably benign Het
Pcf11 A T 7: 92,660,060 D647E probably damaging Het
Plxnd1 T A 6: 115,972,507 I773F probably benign Het
Prl8a1 A T 13: 27,582,103 L3Q probably damaging Het
Psg17 C A 7: 18,818,715 G212C probably damaging Het
Ptbp2 G T 3: 119,753,112 N40K possibly damaging Het
Ptprj T C 2: 90,446,421 H1102R probably damaging Het
Rbfox3 T C 11: 118,513,274 Y33C probably damaging Het
Ros1 T A 10: 52,123,381 N1158Y probably damaging Het
Rpgrip1l T C 8: 91,270,123 I710V probably benign Het
Scn9a A G 2: 66,540,530 F569L probably damaging Het
Slc12a4 A T 8: 105,953,920 M190K probably damaging Het
Slc22a20 G A 19: 5,971,571 R468C probably damaging Het
Slc45a2 T A 15: 11,023,350 Y347N possibly damaging Het
Slc4a10 A G 2: 62,303,862 Y974C probably damaging Het
Snap47 A G 11: 59,428,722 S197P probably benign Het
Snph T C 2: 151,594,253 S252G probably damaging Het
Spns2 A T 11: 72,456,860 W335R probably damaging Het
Thnsl1 A G 2: 21,212,847 I471V probably damaging Het
Tmprss11f C A 5: 86,530,116 G265C probably damaging Het
Tnn C T 1: 160,107,117 R1242H probably benign Het
Tsc2 T C 17: 24,599,630 R1412G probably benign Het
Tsc22d2 G T 3: 58,416,463 V259F unknown Het
Ttll13 A C 7: 80,254,163 K280Q probably damaging Het
Wls A T 3: 159,909,765 I306F possibly damaging Het
Zfp566 A G 7: 30,078,276 V160A probably benign Het
Zfyve28 T C 5: 34,198,875 T761A probably damaging Het
Zswim8 G A 14: 20,714,368 R602Q probably damaging Het
Other mutations in Aox3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:Aox3 APN 1 58169794 missense probably damaging 1.00
IGL01747:Aox3 APN 1 58159658 missense probably damaging 0.97
IGL01883:Aox3 APN 1 58138283 missense probably damaging 1.00
IGL01911:Aox3 APN 1 58152560 missense probably benign 0.04
IGL02017:Aox3 APN 1 58120992 missense probably damaging 1.00
IGL02120:Aox3 APN 1 58127650 missense probably benign 0.00
IGL02466:Aox3 APN 1 58158272 missense probably benign 0.28
IGL02545:Aox3 APN 1 58183486 missense probably damaging 1.00
IGL02572:Aox3 APN 1 58158367 missense probably damaging 1.00
IGL02746:Aox3 APN 1 58183542 missense possibly damaging 0.83
IGL02808:Aox3 APN 1 58142700 missense probably damaging 0.99
IGL02812:Aox3 APN 1 58165896 missense probably benign 0.00
IGL02982:Aox3 APN 1 58127687 missense probably benign 0.00
IGL03056:Aox3 APN 1 58159021 critical splice donor site probably null
IGL03182:Aox3 APN 1 58165887 missense probably benign 0.02
IGL03234:Aox3 APN 1 58152686 missense probably benign
IGL03374:Aox3 APN 1 58171848 missense probably damaging 1.00
amber UTSW 1 58171891 nonsense probably null
R0071:Aox3 UTSW 1 58171891 nonsense probably null
R0071:Aox3 UTSW 1 58171891 nonsense probably null
R0135:Aox3 UTSW 1 58125088 splice site probably benign
R0332:Aox3 UTSW 1 58142751 missense probably benign 0.00
R0626:Aox3 UTSW 1 58172299 missense possibly damaging 0.94
R1325:Aox3 UTSW 1 58176567 nonsense probably null
R1435:Aox3 UTSW 1 58163446 critical splice donor site probably null
R1438:Aox3 UTSW 1 58153178 missense probably benign
R1567:Aox3 UTSW 1 58194693 missense probably damaging 0.96
R1575:Aox3 UTSW 1 58152554 missense probably benign 0.04
R1759:Aox3 UTSW 1 58170646 splice site probably null
R1785:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R1786:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R1921:Aox3 UTSW 1 58180651 missense probably damaging 1.00
R1984:Aox3 UTSW 1 58153061 missense possibly damaging 0.88
R2012:Aox3 UTSW 1 58138232 missense probably benign 0.02
R2080:Aox3 UTSW 1 58186280 missense probably benign 0.06
R2121:Aox3 UTSW 1 58152549 splice site probably benign
R2126:Aox3 UTSW 1 58158216 missense probably benign 0.25
R2130:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R2131:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R2132:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R2133:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R2385:Aox3 UTSW 1 58138289 missense probably damaging 1.00
R2495:Aox3 UTSW 1 58188408 missense probably damaging 0.99
R4200:Aox3 UTSW 1 58188378 missense probably damaging 1.00
R4231:Aox3 UTSW 1 58114885 missense probably benign 0.12
R4591:Aox3 UTSW 1 58152656 missense probably damaging 0.99
R4627:Aox3 UTSW 1 58125035 missense probably damaging 0.98
R4831:Aox3 UTSW 1 58152566 missense probably damaging 0.97
R4864:Aox3 UTSW 1 58176487 missense probably damaging 1.00
R4976:Aox3 UTSW 1 58188524 critical splice donor site probably null
R5007:Aox3 UTSW 1 58163424 missense probably benign
R5119:Aox3 UTSW 1 58188524 critical splice donor site probably null
R5175:Aox3 UTSW 1 58172328 missense probably benign 0.01
R5360:Aox3 UTSW 1 58146508 missense probably damaging 1.00
R5784:Aox3 UTSW 1 58153499 missense probably benign 0.00
R6050:Aox3 UTSW 1 58180655 missense possibly damaging 0.93
R6056:Aox3 UTSW 1 58169859 missense probably damaging 1.00
R6162:Aox3 UTSW 1 58159731 missense possibly damaging 0.75
R6181:Aox3 UTSW 1 58158946 missense probably benign 0.03
R6374:Aox3 UTSW 1 58172161 missense probably benign 0.11
R6662:Aox3 UTSW 1 58118615 missense probably damaging 1.00
R6809:Aox3 UTSW 1 58118681 missense probably damaging 0.99
R6810:Aox3 UTSW 1 58141431 missense probably benign 0.00
R6821:Aox3 UTSW 1 58150388 missense probably benign 0.04
R7039:Aox3 UTSW 1 58176555 missense probably damaging 1.00
R7116:Aox3 UTSW 1 58153530 missense probably benign 0.01
R7163:Aox3 UTSW 1 58119512 missense probably damaging 0.99
R7319:Aox3 UTSW 1 58152602 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGTCCAGGCTTTTCAAACAGG -3'
(R):5'- GCATTGAGTTCCAGAACACGTG -3'

Sequencing Primer
(F):5'- TCCAGGCTTTTCAAACAGGAAGTAG -3'
(R):5'- GTGCCCTGGATCTAGACAATG -3'
Posted On2019-06-26