Incidental Mutation 'R7243:Rbfox3'
ID563376
Institutional Source Beutler Lab
Gene Symbol Rbfox3
Ensembl Gene ENSMUSG00000025576
Gene NameRNA binding protein, fox-1 homolog (C. elegans) 3
SynonymsD11Bwg0517e, NeuN, Neuna60, Hrnbp3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.213) question?
Stock #R7243 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location118489762-118911597 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118513274 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 33 (Y33C)
Ref Sequence ENSEMBL: ENSMUSP00000017576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017576] [ENSMUST00000069343] [ENSMUST00000103023] [ENSMUST00000106278] [ENSMUST00000117731] [ENSMUST00000120061] [ENSMUST00000136551]
Predicted Effect probably damaging
Transcript: ENSMUST00000017576
AA Change: Y33C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000017576
Gene: ENSMUSG00000025576
AA Change: Y33C

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 24 29 N/A INTRINSIC
RRM 100 171 1.01e-24 SMART
Pfam:Fox-1_C 208 269 1e-22 PFAM
Pfam:Fox-1_C 279 345 3.9e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000069343
AA Change: Y33C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069598
Gene: ENSMUSG00000025576
AA Change: Y33C

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 24 29 N/A INTRINSIC
RRM 100 165 8.3e-2 SMART
Pfam:Fox-1_C 176 229 4.1e-15 PFAM
Pfam:Fox-1_C 226 314 4.8e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103023
AA Change: Y33C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099312
Gene: ENSMUSG00000025576
AA Change: Y33C

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 24 29 N/A INTRINSIC
RRM 100 171 1.01e-24 SMART
Pfam:Fox-1_C 207 298 4.2e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106278
AA Change: Y33C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101885
Gene: ENSMUSG00000025576
AA Change: Y33C

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 24 29 N/A INTRINSIC
RRM 100 171 1.01e-24 SMART
Pfam:Fox-1_C 207 298 4.2e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117731
AA Change: Y33C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113636
Gene: ENSMUSG00000025576
AA Change: Y33C

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 24 29 N/A INTRINSIC
RRM 100 171 1.01e-24 SMART
Pfam:Fox-1_C 207 260 3.5e-15 PFAM
Pfam:Fox-1_C 257 345 4.3e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120061
AA Change: Y33C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113987
Gene: ENSMUSG00000025576
AA Change: Y33C

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 24 29 N/A INTRINSIC
RRM 100 171 1.01e-24 SMART
Pfam:Fox-1_C 207 298 6.1e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000136551
AA Change: Y33C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119255
Gene: ENSMUSG00000025576
AA Change: Y33C

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 24 29 N/A INTRINSIC
RRM 100 169 6.65e-20 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (73/74)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit reduced brain weight, increased susceptibility kainic acid-induced seizures, decreased anxiety-related behaviors, and deficits in synaptic transmission and plasticity in the dentate gyrus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A G 9: 92,343,673 Y16C probably damaging Het
Acap1 G A 11: 69,890,471 H103Y probably benign Het
Adamdec1 A G 14: 68,571,754 M253T probably benign Het
Alox15 C A 11: 70,350,714 G114C probably null Het
Aox3 G T 1: 58,138,307 G227V unknown Het
Atp8a2 A T 14: 59,647,842 N1144K probably benign Het
Cacna1c C T 6: 118,637,729 probably null Het
Cog6 A T 3: 53,002,315 W314R probably damaging Het
Col5a2 A G 1: 45,376,160 I1473T probably benign Het
Csmd1 T A 8: 15,915,357 D3218V probably damaging Het
Cyp3a11 A G 5: 145,858,803 M446T probably damaging Het
Dhps A G 8: 85,074,938 Y340C probably benign Het
Dnah7b A G 1: 46,083,754 N108S probably benign Het
Dnajb1 C T 8: 83,610,764 P323L probably damaging Het
Dspp TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG 5: 104,178,361 probably benign Het
Dync2h1 G T 9: 7,102,405 T2665K possibly damaging Het
Etv1 C T 12: 38,857,046 S349L probably benign Het
Fam171a1 A T 2: 3,118,616 T21S probably benign Het
Fbxo18 T A 2: 11,751,525 T749S probably benign Het
Fcho2 T C 13: 98,755,216 D346G possibly damaging Het
Fcrl5 A G 3: 87,442,245 H109R probably benign Het
Fstl1 A G 16: 37,826,726 S153G probably benign Het
Fyb T C 15: 6,643,699 F605L probably benign Het
Gcat T A 15: 79,036,863 M363K possibly damaging Het
Gm10604 T C 4: 11,980,113 T64A unknown Het
Grin2d A G 7: 45,866,128 L147P probably damaging Het
Ift88 A T 14: 57,430,536 probably null Het
Ighg1 A T 12: 113,330,446 C26S Het
Ing2 A G 8: 47,674,539 S48P probably damaging Het
Kat6a C T 8: 22,938,775 T1382I probably benign Het
Kdm1a A G 4: 136,551,954 V765A probably damaging Het
Klk1b26 A G 7: 44,016,913 N260S probably damaging Het
Klk1b26 T C 7: 44,016,267 S168P not run Het
Lama3 G A 18: 12,419,845 G438D probably damaging Het
Larp6 T A 9: 60,713,286 D27E probably benign Het
Lrba T A 3: 86,751,516 probably null Het
Lrig2 A T 3: 104,497,567 probably null Het
Megf9 T C 4: 70,435,471 E366G probably benign Het
Mob1b T A 5: 88,743,445 D52E probably damaging Het
Ndufb3 A T 1: 58,591,123 H11L unknown Het
Odc1 T G 12: 17,550,057 Y407* probably null Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr328 T C 11: 58,551,401 I279M probably damaging Het
Olfr401 T A 11: 74,121,733 V148E probably damaging Het
Olfr561 A T 7: 102,781,658 T61S probably benign Het
Olfr642 A G 7: 104,049,755 Y200H probably damaging Het
Opa1 A G 16: 29,586,996 I126M probably benign Het
Pcca A G 14: 122,876,774 H633R probably benign Het
Pcdhb22 A G 18: 37,520,632 R461G probably benign Het
Pcf11 A T 7: 92,660,060 D647E probably damaging Het
Plxnd1 T A 6: 115,972,507 I773F probably benign Het
Prl8a1 A T 13: 27,582,103 L3Q probably damaging Het
Psg17 C A 7: 18,818,715 G212C probably damaging Het
Ptbp2 G T 3: 119,753,112 N40K possibly damaging Het
Ptprj T C 2: 90,446,421 H1102R probably damaging Het
Ros1 T A 10: 52,123,381 N1158Y probably damaging Het
Rpgrip1l T C 8: 91,270,123 I710V probably benign Het
Scn9a A G 2: 66,540,530 F569L probably damaging Het
Slc12a4 A T 8: 105,953,920 M190K probably damaging Het
Slc22a20 G A 19: 5,971,571 R468C probably damaging Het
Slc45a2 T A 15: 11,023,350 Y347N possibly damaging Het
Slc4a10 A G 2: 62,303,862 Y974C probably damaging Het
Snap47 A G 11: 59,428,722 S197P probably benign Het
Snph T C 2: 151,594,253 S252G probably damaging Het
Spns2 A T 11: 72,456,860 W335R probably damaging Het
Thnsl1 A G 2: 21,212,847 I471V probably damaging Het
Tmprss11f C A 5: 86,530,116 G265C probably damaging Het
Tnn C T 1: 160,107,117 R1242H probably benign Het
Tsc2 T C 17: 24,599,630 R1412G probably benign Het
Tsc22d2 G T 3: 58,416,463 V259F unknown Het
Ttll13 A C 7: 80,254,163 K280Q probably damaging Het
Wls A T 3: 159,909,765 I306F possibly damaging Het
Zfp566 A G 7: 30,078,276 V160A probably benign Het
Zfyve28 T C 5: 34,198,875 T761A probably damaging Het
Zswim8 G A 14: 20,714,368 R602Q probably damaging Het
Other mutations in Rbfox3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01352:Rbfox3 APN 11 118505613 splice site probably benign
IGL01622:Rbfox3 APN 11 118505614 splice site probably benign
IGL01623:Rbfox3 APN 11 118505614 splice site probably benign
IGL01716:Rbfox3 APN 11 118513289 missense possibly damaging 0.89
IGL01772:Rbfox3 APN 11 118496971 missense probably damaging 0.98
IGL03162:Rbfox3 APN 11 118496431 missense probably benign 0.06
PIT4431001:Rbfox3 UTSW 11 118495221 missense probably damaging 1.00
R0267:Rbfox3 UTSW 11 118495240 missense probably benign 0.00
R1659:Rbfox3 UTSW 11 118494155 missense probably damaging 0.99
R1681:Rbfox3 UTSW 11 118505669 missense probably damaging 1.00
R1698:Rbfox3 UTSW 11 118495221 missense probably damaging 1.00
R1731:Rbfox3 UTSW 11 118496936 critical splice donor site probably null
R2134:Rbfox3 UTSW 11 118497016 missense probably damaging 1.00
R2249:Rbfox3 UTSW 11 118503738 missense probably damaging 0.99
R3051:Rbfox3 UTSW 11 118502888 missense probably damaging 1.00
R3404:Rbfox3 UTSW 11 118496457 missense possibly damaging 0.93
R3405:Rbfox3 UTSW 11 118496457 missense possibly damaging 0.93
R3406:Rbfox3 UTSW 11 118496457 missense possibly damaging 0.93
R5276:Rbfox3 UTSW 11 118496352 missense probably damaging 1.00
X0013:Rbfox3 UTSW 11 118497041 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- CTAGAAAGTTCTACCCAGCCAG -3'
(R):5'- TCCCTTGAAGGCTCTGGAAG -3'

Sequencing Primer
(F):5'- GTTCTACCCAGCCAGCATGTAG -3'
(R):5'- CTCTGGAAGGGACAGGGGTTC -3'
Posted On2019-06-26