Incidental Mutation 'R7243:Odc1'
ID563377
Institutional Source Beutler Lab
Gene Symbol Odc1
Ensembl Gene ENSMUSG00000011179
Gene Nameornithine decarboxylase, structural 1
SynonymsODC
MMRRC Submission
Accession Numbers

Genbank: NM_013614.2

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7243 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location17544794-17551505 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to G at 17550057 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 407 (Y407*)
Ref Sequence ENSEMBL: ENSMUSP00000128661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171737] [ENSMUST00000222617]
PDB Structure
CRYSTAL STRUCTURE ORNITHINE DECARBOXYLASE FROM MOUSE, TRUNCATED 37 RESIDUES FROM THE C-TERMINUS, TO 1.6 ANGSTROM RESOLUTION [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000171737
AA Change: Y407*
SMART Domains Protein: ENSMUSP00000128661
Gene: ENSMUSG00000011179
AA Change: Y407*

DomainStartEndE-ValueType
Pfam:Orn_Arg_deC_N 44 282 2.2e-93 PFAM
Pfam:Orn_DAP_Arg_deC 286 407 1.7e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221613
Predicted Effect probably benign
Transcript: ENSMUST00000222617
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the rate-limiting enzyme of the polyamine biosynthesis pathway which catalyzes ornithine to putrescine. The activity level for the enzyme varies in response to growth-promoting stimuli and exhibits a high turnover rate in comparison to other mammalian proteins. Originally localized to both chromosomes 2 and 7, the gene encoding this enzyme has been determined to be located on 2p25, with a pseudogene located on 7q31-qter. Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous null embryos die prior to gastrulation. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, other(3) Gene trapped(6)  

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A G 9: 92,343,673 Y16C probably damaging Het
Acap1 G A 11: 69,890,471 H103Y probably benign Het
Adamdec1 A G 14: 68,571,754 M253T probably benign Het
Alox15 C A 11: 70,350,714 G114C probably null Het
Aox3 G T 1: 58,138,307 G227V unknown Het
Atp8a2 A T 14: 59,647,842 N1144K probably benign Het
Cacna1c C T 6: 118,637,729 probably null Het
Cog6 A T 3: 53,002,315 W314R probably damaging Het
Col5a2 A G 1: 45,376,160 I1473T probably benign Het
Csmd1 T A 8: 15,915,357 D3218V probably damaging Het
Cyp3a11 A G 5: 145,858,803 M446T probably damaging Het
Dhps A G 8: 85,074,938 Y340C probably benign Het
Dnah7b A G 1: 46,083,754 N108S probably benign Het
Dnajb1 C T 8: 83,610,764 P323L probably damaging Het
Dspp TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG 5: 104,178,361 probably benign Het
Dync2h1 G T 9: 7,102,405 T2665K possibly damaging Het
Etv1 C T 12: 38,857,046 S349L probably benign Het
Fam171a1 A T 2: 3,118,616 T21S probably benign Het
Fbxo18 T A 2: 11,751,525 T749S probably benign Het
Fcho2 T C 13: 98,755,216 D346G possibly damaging Het
Fcrl5 A G 3: 87,442,245 H109R probably benign Het
Fstl1 A G 16: 37,826,726 S153G probably benign Het
Fyb T C 15: 6,643,699 F605L probably benign Het
Gcat T A 15: 79,036,863 M363K possibly damaging Het
Gm10604 T C 4: 11,980,113 T64A unknown Het
Grin2d A G 7: 45,866,128 L147P probably damaging Het
Ift88 A T 14: 57,430,536 probably null Het
Ighg1 A T 12: 113,330,446 C26S Het
Ing2 A G 8: 47,674,539 S48P probably damaging Het
Kat6a C T 8: 22,938,775 T1382I probably benign Het
Kdm1a A G 4: 136,551,954 V765A probably damaging Het
Klk1b26 T C 7: 44,016,267 S168P not run Het
Klk1b26 A G 7: 44,016,913 N260S probably damaging Het
Lama3 G A 18: 12,419,845 G438D probably damaging Het
Larp6 T A 9: 60,713,286 D27E probably benign Het
Lrba T A 3: 86,751,516 probably null Het
Lrig2 A T 3: 104,497,567 probably null Het
Megf9 T C 4: 70,435,471 E366G probably benign Het
Mob1b T A 5: 88,743,445 D52E probably damaging Het
Ndufb3 A T 1: 58,591,123 H11L unknown Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr328 T C 11: 58,551,401 I279M probably damaging Het
Olfr401 T A 11: 74,121,733 V148E probably damaging Het
Olfr561 A T 7: 102,781,658 T61S probably benign Het
Olfr642 A G 7: 104,049,755 Y200H probably damaging Het
Opa1 A G 16: 29,586,996 I126M probably benign Het
Pcca A G 14: 122,876,774 H633R probably benign Het
Pcdhb22 A G 18: 37,520,632 R461G probably benign Het
Pcf11 A T 7: 92,660,060 D647E probably damaging Het
Plxnd1 T A 6: 115,972,507 I773F probably benign Het
Prl8a1 A T 13: 27,582,103 L3Q probably damaging Het
Psg17 C A 7: 18,818,715 G212C probably damaging Het
Ptbp2 G T 3: 119,753,112 N40K possibly damaging Het
Ptprj T C 2: 90,446,421 H1102R probably damaging Het
Rbfox3 T C 11: 118,513,274 Y33C probably damaging Het
Ros1 T A 10: 52,123,381 N1158Y probably damaging Het
Rpgrip1l T C 8: 91,270,123 I710V probably benign Het
Scn9a A G 2: 66,540,530 F569L probably damaging Het
Slc12a4 A T 8: 105,953,920 M190K probably damaging Het
Slc22a20 G A 19: 5,971,571 R468C probably damaging Het
Slc45a2 T A 15: 11,023,350 Y347N possibly damaging Het
Slc4a10 A G 2: 62,303,862 Y974C probably damaging Het
Snap47 A G 11: 59,428,722 S197P probably benign Het
Snph T C 2: 151,594,253 S252G probably damaging Het
Spns2 A T 11: 72,456,860 W335R probably damaging Het
Thnsl1 A G 2: 21,212,847 I471V probably damaging Het
Tmprss11f C A 5: 86,530,116 G265C probably damaging Het
Tnn C T 1: 160,107,117 R1242H probably benign Het
Tsc2 T C 17: 24,599,630 R1412G probably benign Het
Tsc22d2 G T 3: 58,416,463 V259F unknown Het
Ttll13 A C 7: 80,254,163 K280Q probably damaging Het
Wls A T 3: 159,909,765 I306F possibly damaging Het
Zfp566 A G 7: 30,078,276 V160A probably benign Het
Zfyve28 T C 5: 34,198,875 T761A probably damaging Het
Zswim8 G A 14: 20,714,368 R602Q probably damaging Het
Other mutations in Odc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02135:Odc1 APN 12 17547673 missense probably damaging 1.00
IGL02234:Odc1 APN 12 17548620 missense possibly damaging 0.95
IGL03007:Odc1 APN 12 17548810 missense probably benign 0.01
F5426:Odc1 UTSW 12 17549423 critical splice acceptor site probably null
H8562:Odc1 UTSW 12 17548037 missense probably benign 0.11
R1648:Odc1 UTSW 12 17548537 splice site probably benign
R1898:Odc1 UTSW 12 17548841 missense probably damaging 1.00
R2224:Odc1 UTSW 12 17547335 missense probably benign 0.05
R2274:Odc1 UTSW 12 17548424 missense probably benign 0.01
R3932:Odc1 UTSW 12 17548800 missense probably benign 0.38
R4883:Odc1 UTSW 12 17547385 missense possibly damaging 0.82
R4956:Odc1 UTSW 12 17547957 missense probably damaging 1.00
R5036:Odc1 UTSW 12 17548019 missense probably damaging 1.00
R6112:Odc1 UTSW 12 17549472 missense probably benign 0.23
R6261:Odc1 UTSW 12 17550654 missense probably benign 0.00
R7092:Odc1 UTSW 12 17548313 missense possibly damaging 0.90
R7101:Odc1 UTSW 12 17547318 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAAGCCAGACGAGAAGTATTACTC -3'
(R):5'- CCTTTTCTTGAGACAGGCAAGC -3'

Sequencing Primer
(F):5'- GAGAAGTATTACTCATCCAGCATCTG -3'
(R):5'- ATTCTATCAAGGCCCTCACTCAAGTG -3'
Posted On2019-06-26