Incidental Mutation 'R7247:Fgfrl1'
ID563602
Institutional Source Beutler Lab
Gene Symbol Fgfrl1
Ensembl Gene ENSMUSG00000008090
Gene Namefibroblast growth factor receptor-like 1
SynonymsFGFR5, FGFR5beta, FGFR5gamma, fibroblast growth factor receptor 5
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7247 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location108692382-108706924 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108703499 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 94 (V94A)
Ref Sequence ENSEMBL: ENSMUSP00000013633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013633] [ENSMUST00000112560] [ENSMUST00000196222] [ENSMUST00000197255]
Predicted Effect possibly damaging
Transcript: ENSMUST00000013633
AA Change: V94A

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000013633
Gene: ENSMUSG00000008090
AA Change: V94A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 38 102 2.64e-12 SMART
low complexity region 117 131 N/A INTRINSIC
IGc2 159 224 1.35e-18 SMART
IGc2 255 341 6.16e-4 SMART
transmembrane domain 372 394 N/A INTRINSIC
low complexity region 468 479 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112560
SMART Domains Protein: ENSMUSP00000108179
Gene: ENSMUSG00000008090

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 26 40 N/A INTRINSIC
IGc2 68 133 1.35e-18 SMART
IGc2 164 250 6.16e-4 SMART
transmembrane domain 281 303 N/A INTRINSIC
low complexity region 377 388 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000196222
AA Change: V94A

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143037
Gene: ENSMUSG00000008090
AA Change: V94A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 38 102 1.1e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197255
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor receptor (FGFR) family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein would consist of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. A marked difference between this gene product and the other family members is its lack of a cytoplasmic tyrosine kinase domain. The result is a transmembrane receptor that could interact with other family members and potentially inhibit signaling. Multiple alternatively spliced transcript variants encoding the same isoform have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show neonatal death due to respiratory distress, a malformed diaphragm, and lack of metanephric kidneys. Homozygotes for a different null allele show both fetal and neonatal death, a similar diaphragm defect, as well as cardiac and skeletal defects, and fetal anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428F04Rik A T 8: 105,284,699 Y268N probably benign Het
Abca13 A G 11: 9,290,732 E865G probably benign Het
Actrt2 A C 4: 154,667,423 D85E probably benign Het
Ankrd55 A G 13: 112,336,253 E153G probably damaging Het
Arfgef3 T A 10: 18,625,391 H1037L probably benign Het
Camk2a A G 18: 60,943,205 Y85C unknown Het
Caprin1 A T 2: 103,779,474 V153E possibly damaging Het
Caskin2 G A 11: 115,801,896 P688S probably benign Het
Catsper2 TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT 2: 121,397,572 probably benign Het
Ccdc116 T C 16: 17,139,691 T535A possibly damaging Het
Cdh9 G A 15: 16,778,255 R52H probably damaging Het
Cdk5rap2 A G 4: 70,337,429 L406S probably damaging Het
Cep350 A G 1: 155,910,753 M1449T probably damaging Het
Chst8 T A 7: 34,675,936 K159N probably damaging Het
Dcdc2a A G 13: 25,102,391 H136R probably benign Het
Dip2a C T 10: 76,272,532 probably null Het
Dock2 G A 11: 34,714,513 R260* probably null Het
Dscam A G 16: 96,820,808 V481A probably damaging Het
E130308A19Rik A G 4: 59,690,502 D112G probably damaging Het
Ezh2 T C 6: 47,533,774 K634E probably damaging Het
Fcgr2b A G 1: 170,965,700 probably null Het
Gm31371 A G 8: 19,903,421 N10S Het
Gpr156 C A 16: 37,947,741 N6K probably damaging Het
Gsdmc2 A T 15: 63,833,334 F177I probably benign Het
Igkv4-54 T A 6: 69,631,858 S26C probably damaging Het
Iglc3 T C 16: 19,065,441 H80R Het
Immp1l G A 2: 105,937,056 G87S probably damaging Het
Itgav A T 2: 83,724,835 D34V probably damaging Het
Lrp1b G A 2: 41,269,212 T1686I Het
Ltn1 T C 16: 87,409,387 D935G probably benign Het
Map3k8 T C 18: 4,334,036 D352G probably damaging Het
Map3k9 T C 12: 81,725,830 K610E possibly damaging Het
March4 G T 1: 72,452,478 Y211* probably null Het
Marf1 A T 16: 14,127,093 L1304Q probably damaging Het
Mecom A G 3: 30,140,356 V5A unknown Het
Mep1a A T 17: 43,475,104 V711D possibly damaging Het
Naca T A 10: 128,042,598 D1166E unknown Het
Neb G T 2: 52,258,741 P2598Q probably damaging Het
Notch4 A T 17: 34,572,517 E546V probably damaging Het
Nudt18 A G 14: 70,577,982 T12A unknown Het
Nvl A C 1: 181,112,286 probably null Het
Obscn G T 11: 59,103,318 C1579* probably null Het
Olfr142 G A 2: 90,252,821 P56S probably damaging Het
Olfr27 T A 9: 39,144,857 Y252* probably null Het
Olfr78 T C 7: 102,742,344 I220V probably damaging Het
Olfr785 T C 10: 129,410,182 V272A probably damaging Het
Olfr853 A T 9: 19,537,333 I199K probably benign Het
Oxa1l A T 14: 54,360,855 M1L probably benign Het
Paqr9 A G 9: 95,560,193 T79A possibly damaging Het
Plec A T 15: 76,177,343 V2798E probably damaging Het
Ptpn4 A T 1: 119,690,034 *557R probably null Het
Ptprt T C 2: 161,533,523 E1379G probably benign Het
Rad18 G T 6: 112,665,325 T327K possibly damaging Het
Rps2 T A 17: 24,720,580 I75N possibly damaging Het
Scgb2b2 A T 7: 31,303,596 R39W probably damaging Het
Sh3d21 A G 4: 126,152,115 F307S probably benign Het
Snap91 A G 9: 86,792,616 V507A unknown Het
Srgap1 T A 10: 121,869,790 Y243F probably damaging Het
Stim1 T A 7: 102,421,532 probably null Het
Top2b T C 14: 16,416,962 V1161A probably benign Het
Tpcn1 T C 5: 120,585,250 D16G possibly damaging Het
Trank1 A T 9: 111,367,512 I1535F probably damaging Het
Txnrd2 T C 16: 18,456,072 F278L probably damaging Het
Ufl1 A T 4: 25,254,637 D579E probably damaging Het
Vps45 T C 3: 96,041,405 N346S probably benign Het
Vps51 T A 19: 6,077,389 probably benign Het
Zfp536 T C 7: 37,569,206 N262D probably benign Het
Zmynd10 A G 9: 107,548,777 I103M possibly damaging Het
Zswim1 C T 2: 164,825,799 H324Y possibly damaging Het
Zxdc T C 6: 90,384,173 W507R unknown Het
Other mutations in Fgfrl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Fgfrl1 APN 5 108705887 missense probably damaging 1.00
IGL00756:Fgfrl1 APN 5 108705953 missense possibly damaging 0.91
IGL02641:Fgfrl1 APN 5 108705865 missense probably damaging 1.00
R0725:Fgfrl1 UTSW 5 108704673 missense probably damaging 0.99
R1398:Fgfrl1 UTSW 5 108706281 unclassified probably benign
R1967:Fgfrl1 UTSW 5 108705005 missense probably damaging 1.00
R2403:Fgfrl1 UTSW 5 108705031 missense probably damaging 1.00
R3032:Fgfrl1 UTSW 5 108706060 missense probably benign 0.13
R3605:Fgfrl1 UTSW 5 108705423 missense probably damaging 0.96
R3606:Fgfrl1 UTSW 5 108705423 missense probably damaging 0.96
R3607:Fgfrl1 UTSW 5 108705423 missense probably damaging 0.96
R3767:Fgfrl1 UTSW 5 108705376 missense possibly damaging 0.78
R4603:Fgfrl1 UTSW 5 108703535 missense probably damaging 1.00
R4798:Fgfrl1 UTSW 5 108703497 nonsense probably null
R5600:Fgfrl1 UTSW 5 108705302 missense probably damaging 1.00
R6349:Fgfrl1 UTSW 5 108705506 missense probably damaging 1.00
R6679:Fgfrl1 UTSW 5 108704972 nonsense probably null
R6679:Fgfrl1 UTSW 5 108704973 missense probably damaging 1.00
X0018:Fgfrl1 UTSW 5 108704974 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTCCTCTAACTCTTGCAGGAC -3'
(R):5'- TTGGTGCAGGCAAAACAAGC -3'

Sequencing Primer
(F):5'- TGGCAGACAAAGTGGTCCCAC -3'
(R):5'- CAAGCAGGGTGGGAGAATCC -3'
Posted On2019-06-26