Incidental Mutation 'R0579:4921517D22Rik'
List |< first << previous [record 6 of 1259] next >> last >|
ID56364
Institutional Source Beutler Lab
Gene Symbol 4921517D22Rik
Ensembl Gene ENSMUSG00000049902
Gene NameRIKEN cDNA 4921517D22 gene
Synonyms
MMRRC Submission 038769-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R0579 (G1)
Quality Score212
Status Validated
Chromosome13
Chromosomal Location59687402-59694108 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GCC to GC at 59691598 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153380 (fasta)
Gene Model
Predicted Effect probably null
Transcript: ENSMUST00000061597
Predicted Effect probably null
Transcript: ENSMUST00000225373
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225788
Meta Mutation Damage Score 0.6464 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency 89% (34/38)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 G A 16: 20,550,648 R260Q probably benign Het
Abcg3 A G 5: 104,974,103 V136A probably damaging Het
Acr C G 15: 89,569,475 H72Q probably damaging Het
Ambra1 A G 2: 91,824,465 N783S possibly damaging Het
Cd300ld2 A G 11: 115,012,299 F240S probably benign Het
Cep83 A G 10: 94,749,053 D340G possibly damaging Het
Crybg2 T A 4: 134,072,738 I403N probably damaging Het
Dnah14 T A 1: 181,744,747 M2881K possibly damaging Het
Erbb4 T C 1: 68,042,462 M1138V probably benign Het
Evi5 A G 5: 107,821,709 V112A probably benign Het
F2r A G 13: 95,618,349 V9A probably benign Het
Flot1 C A 17: 35,831,008 S337R probably benign Het
Glt28d2 G A 3: 85,872,133 T11I probably damaging Het
Gm19345 A G 7: 19,854,976 probably benign Het
Gm6605 C A 7: 38,448,275 noncoding transcript Het
Hmgcs2 A T 3: 98,290,948 I56F probably damaging Het
Ifna9 T A 4: 88,592,271 T39S possibly damaging Het
Il21 T G 3: 37,227,774 K74Q possibly damaging Het
Itpripl1 G T 2: 127,141,091 Y370* probably null Het
Kif24 G A 4: 41,393,706 P1056S probably damaging Het
L2hgdh A T 12: 69,701,272 probably benign Het
Lipo2 A T 19: 33,746,898 L156Q probably damaging Het
Nlrp4c T A 7: 6,060,845 M84K probably benign Het
Npy4r G A 14: 34,146,683 T216I probably benign Het
Olfr109 T C 17: 37,466,347 V47A probably benign Het
Olfr802 A T 10: 129,682,237 C167* probably null Het
Olfr92 G C 17: 37,111,455 L176V probably benign Het
Pafah1b2 T C 9: 45,968,713 E222G probably benign Het
Pop1 T A 15: 34,509,969 D406E possibly damaging Het
Proser1 A G 3: 53,467,151 Y32C probably damaging Het
Ptprj C A 2: 90,436,569 probably null Het
Slc1a3 T A 15: 8,688,309 I100F probably damaging Het
Slc25a22 T C 7: 141,431,359 D176G probably damaging Het
Stard7 T C 2: 127,284,553 V99A probably damaging Het
Stk33 C T 7: 109,325,697 V184I probably damaging Het
Timmdc1 A G 16: 38,522,383 L51P probably benign Het
Tppp T C 13: 74,021,233 S31P probably benign Het
Upf2 A T 2: 5,988,429 R599W unknown Het
Vav1 G T 17: 57,279,271 W25L probably benign Het
Other mutations in 4921517D22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00827:4921517D22Rik APN 13 59689476 missense probably benign 0.00
IGL01516:4921517D22Rik APN 13 59690734 missense probably benign 0.00
R0395:4921517D22Rik UTSW 13 59689656 missense possibly damaging 0.94
R0664:4921517D22Rik UTSW 13 59691598 frame shift probably null
R0757:4921517D22Rik UTSW 13 59691598 frame shift probably null
R0758:4921517D22Rik UTSW 13 59691598 frame shift probably null
R0777:4921517D22Rik UTSW 13 59691598 frame shift probably null
R0779:4921517D22Rik UTSW 13 59691598 frame shift probably null
R0814:4921517D22Rik UTSW 13 59691598 frame shift probably null
R0870:4921517D22Rik UTSW 13 59691598 frame shift probably null
R0872:4921517D22Rik UTSW 13 59691598 frame shift probably null
R0873:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1062:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1064:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1149:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1149:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1151:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1152:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1207:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1207:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1285:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1339:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1358:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1359:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1360:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1361:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1679:4921517D22Rik UTSW 13 59691598 frame shift probably null
R4703:4921517D22Rik UTSW 13 59689528 missense possibly damaging 0.94
R4785:4921517D22Rik UTSW 13 59691592 missense probably benign
R4823:4921517D22Rik UTSW 13 59690904 missense probably damaging 0.99
R5054:4921517D22Rik UTSW 13 59689501 missense probably damaging 0.97
R6144:4921517D22Rik UTSW 13 59689533 missense probably damaging 0.99
R6977:4921517D22Rik UTSW 13 59691580 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- ACTGAAATGAAACTCCGGTGCCC -3'
(R):5'- TCACCAATGAAATGGTCAGAGCTGC -3'

Sequencing Primer
(F):5'- TCGCCTGCATGTGGTATCAT -3'
(R):5'- GCTACTTGAAACATGATTGACTCGAC -3'
Posted On2013-07-11