Incidental Mutation 'R7250:Gstm1'
ID563808
Institutional Source Beutler Lab
Gene Symbol Gstm1
Ensembl Gene ENSMUSG00000058135
Gene Nameglutathione S-transferase, mu 1
SynonymsGstb-1, Gstb1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R7250 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location108012255-108017973 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108016393 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 99 (I99F)
Ref Sequence ENSEMBL: ENSMUSP00000004140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004140] [ENSMUST00000126593] [ENSMUST00000153314]
Predicted Effect probably damaging
Transcript: ENSMUST00000004140
AA Change: I99F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000004140
Gene: ENSMUSG00000058135
AA Change: I99F

DomainStartEndE-ValueType
Pfam:GST_N 3 82 1.3e-20 PFAM
Pfam:GST_C_3 40 190 5.2e-11 PFAM
Pfam:GST_C 104 192 3.7e-18 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000118874
Gene: ENSMUSG00000058135
AA Change: I99F

DomainStartEndE-ValueType
Pfam:GST_N 3 82 8.3e-24 PFAM
Pfam:GST_C 104 201 6.7e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000153314
AA Change: I40F

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123481
Gene: ENSMUSG00000058135
AA Change: I40F

DomainStartEndE-ValueType
Pfam:GST_N 1 23 1.7e-7 PFAM
Pfam:GST_C 45 168 1.2e-18 PFAM
Pfam:GST_C_3 92 166 8.3e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-transferase that belongs to the mu class. The mu class of enzymes functions in the detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione. The genes encoding the mu class of enzymes are organized in a gene cluster on chromosome 1p13.3 and are known to be highly polymorphic. These genetic variations can change an individual's susceptibility to carcinogens and toxins as well as affect the toxicity and efficacy of certain drugs. Diversification of these genes has occurred in regions encoding substrate-binding domains, as well as in tissue expression patterns, to accommodate an increasing number of foreign compounds. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for the deletion of this gene display a reduced ability to metabolize 1,2-dichloro-4-nitrobenzene. Mice homozygous for a different knock-out allele exhibit abnormal behavior, altered response to valproic acid, and increased serotonin and dopamine levels in the cerebellum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930480E11Rik G T X: 78,370,705 M345I probably benign Het
Actl7b T A 4: 56,741,035 M108L probably benign Het
Adgrf3 T A 5: 30,195,682 I934L probably damaging Het
Adprm A G 11: 67,041,624 V153A probably benign Het
Aif1l G A 2: 31,969,752 V109M probably damaging Het
Asphd1 T A 7: 126,946,770 E307V probably damaging Het
Ate1 T A 7: 130,519,971 probably benign Het
BC048403 T C 10: 121,745,471 S126P possibly damaging Het
BC067074 T G 13: 113,318,815 I465R Het
Borcs7 A G 19: 46,699,608 H64R probably damaging Het
C1qtnf1 A G 11: 118,448,350 *282W probably null Het
Cacna1c A G 6: 118,598,005 C1985R Het
Cacna1c A T 6: 118,696,451 V647E Het
Cacna1d A G 14: 30,075,151 S1497P probably damaging Het
Cacna1e T A 1: 154,700,489 I133F possibly damaging Het
Ccdc63 A T 5: 122,122,843 L206H probably damaging Het
Ccdc84 A G 9: 44,412,451 probably null Het
D430041D05Rik T C 2: 104,256,616 T672A possibly damaging Het
D630045J12Rik G T 6: 38,142,611 T1732K possibly damaging Het
D930020B18Rik T C 10: 121,671,831 I158T probably damaging Het
Ddx52 G A 11: 83,944,566 G106D probably benign Het
Dock2 A G 11: 34,695,205 V550A probably benign Het
Dock2 C T 11: 34,695,293 D521N probably damaging Het
F13b T C 1: 139,516,489 probably null Het
Fchsd2 A G 7: 101,259,685 K431R possibly damaging Het
Fez1 C T 9: 36,867,794 R256C probably damaging Het
Gjd4 T A 18: 9,280,391 Q229L probably benign Het
Gpr45 T A 1: 43,032,371 I58N probably damaging Het
Gtpbp8 T A 16: 44,743,862 T149S probably damaging Het
H2-Ab1 A G 17: 34,267,507 D180G probably damaging Het
Hdhd5 A G 6: 120,517,055 I188T possibly damaging Het
Hfm1 T C 5: 106,904,331 I300V probably benign Het
Hnrnpr T G 4: 136,332,435 D283E probably benign Het
Hsp90b1 T C 10: 86,691,708 E768G unknown Het
Kcna4 C A 2: 107,296,318 Q466K possibly damaging Het
Kcnk6 A G 7: 29,232,194 L97P probably benign Het
Kdelc2 C T 9: 53,390,521 Q158* probably null Het
Klf5 A G 14: 99,299,019 S9G probably benign Het
Kmt2c C A 5: 25,299,491 K3606N probably damaging Het
Kmt2c T C 5: 25,309,807 T3013A probably benign Het
Lancl1 A G 1: 67,009,299 Y207H possibly damaging Het
Lipe G C 7: 25,388,660 probably benign Het
Lrrc66 T A 5: 73,610,881 H239L probably benign Het
Ltbp2 C T 12: 84,787,392 W1441* probably null Het
Man2a1 T C 17: 64,636,588 S213P probably benign Het
Mapre2 C T 18: 23,858,062 A171V possibly damaging Het
Mdn1 T A 4: 32,695,427 D1155E probably damaging Het
Mki67 T C 7: 135,699,324 D1327G possibly damaging Het
Mx2 T C 16: 97,547,464 I279T probably damaging Het
Myo5c A G 9: 75,262,215 T441A probably damaging Het
Nlrp9a T G 7: 26,558,718 V587G possibly damaging Het
Npas2 A T 1: 39,338,107 T517S probably damaging Het
Npy1r T C 8: 66,705,060 S341P probably benign Het
Ntm A G 9: 29,411,692 W11R probably benign Het
Nxpe2 A T 9: 48,326,796 I53N possibly damaging Het
Olfr456 A G 6: 42,486,755 V146A probably benign Het
Olfr655 A T 7: 104,596,531 Y217N probably damaging Het
Olfr981 T A 9: 40,022,754 Y120* probably null Het
Onecut2 T C 18: 64,386,440 F443L probably benign Het
Parp2 T A 14: 50,817,344 V248E probably benign Het
Pcdh12 C A 18: 38,281,976 V699L probably benign Het
Pja2 G A 17: 64,309,456 P148L probably benign Het
Ppip5k2 T G 1: 97,745,462 D415A probably benign Het
Prss47 A G 13: 65,052,541 S74P probably benign Het
Ptprg G T 14: 12,166,767 M723I probably benign Het
Qsox2 A T 2: 26,228,432 I109N probably damaging Het
Ranbp3l A G 15: 9,011,980 E217G probably benign Het
Rgl2 C T 17: 33,933,429 R367W probably damaging Het
Rgs12 T A 5: 34,965,497 F208Y probably damaging Het
Rin3 C T 12: 102,368,634 T268I unknown Het
Rttn T A 18: 88,989,523 D427E probably benign Het
Samd13 G A 3: 146,646,324 P91S probably benign Het
Samd9l T C 6: 3,374,201 D1020G possibly damaging Het
Sec62 T G 3: 30,812,347 L201V possibly damaging Het
Setdb1 C T 3: 95,354,541 probably null Het
Sf3a3 A T 4: 124,722,915 T197S probably benign Het
Slc20a1 A T 2: 129,209,924 I618F possibly damaging Het
Slc38a3 A T 9: 107,656,666 M186K probably benign Het
Slc39a13 T C 2: 91,063,158 T319A probably benign Het
Slc44a4 T C 17: 34,918,544 probably null Het
St3gal1 A C 15: 67,106,729 D314E possibly damaging Het
Suclg1 A G 6: 73,271,091 N265S probably benign Het
Sult2b1 A T 7: 45,783,937 V2D unknown Het
Supv3l1 T A 10: 62,445,067 I182F probably damaging Het
Tcp11l2 T C 10: 84,587,241 probably null Het
Tenm2 C A 11: 36,072,798 L935F probably damaging Het
Tnks T A 8: 34,851,758 I790F probably damaging Het
Top2b C T 14: 16,420,411 T1274I probably benign Het
Tpi1 A T 6: 124,812,478 I178N probably damaging Het
Trav9d-1 A T 14: 52,792,696 S86C probably damaging Het
Treml2 A G 17: 48,309,127 E265G probably benign Het
Trpm7 A T 2: 126,826,765 S744T possibly damaging Het
Usp33 T A 3: 152,392,362 L909* probably null Het
Vcan A G 13: 89,721,686 I210T probably damaging Het
Vcan A T 13: 89,731,457 probably null Het
Vsig10l A T 7: 43,463,675 D17V probably benign Het
Zbtb7b T A 3: 89,379,669 T498S probably benign Het
Zfp366 T A 13: 99,229,568 H412Q probably damaging Het
Zfp53 C A 17: 21,509,578 D624E probably damaging Het
Zfp827 A T 8: 79,190,092 D432V Het
Zic1 T C 9: 91,364,975 T15A probably damaging Het
Zswim8 T C 14: 20,719,968 C1368R probably damaging Het
Other mutations in Gstm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0335:Gstm1 UTSW 3 108012696 missense possibly damaging 0.87
R0458:Gstm1 UTSW 3 108017363 missense probably benign 0.01
R0907:Gstm1 UTSW 3 108017380 missense probably damaging 1.00
R1069:Gstm1 UTSW 3 108012748 missense probably damaging 1.00
R1180:Gstm1 UTSW 3 108014811 missense probably damaging 1.00
R1181:Gstm1 UTSW 3 108014811 missense probably damaging 1.00
R1998:Gstm1 UTSW 3 108014811 missense probably damaging 1.00
R2000:Gstm1 UTSW 3 108014811 missense probably damaging 1.00
R4483:Gstm1 UTSW 3 108016518 critical splice donor site probably null
R4857:Gstm1 UTSW 3 108016408 missense possibly damaging 0.67
R5192:Gstm1 UTSW 3 108014943 critical splice donor site probably null
R5262:Gstm1 UTSW 3 108016363 missense probably benign 0.01
R5356:Gstm1 UTSW 3 108012736 missense probably benign 0.00
R5485:Gstm1 UTSW 3 108017404 missense probably damaging 1.00
R6323:Gstm1 UTSW 3 108017747 missense probably benign 0.44
R7165:Gstm1 UTSW 3 108016377 missense probably benign
X0023:Gstm1 UTSW 3 108012727 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTCATCCTGCTGGTAAGATC -3'
(R):5'- CAGCTGCCTTACTTGATCGATG -3'

Sequencing Primer
(F):5'- TCATCCTGCTGGTAAGATCAGAAAGC -3'
(R):5'- GATCGATGGATCACACAAGATCAC -3'
Posted On2019-06-26