Incidental Mutation 'R7250:D930020B18Rik'
ID563855
Institutional Source Beutler Lab
Gene Symbol D930020B18Rik
Ensembl Gene ENSMUSG00000047642
Gene NameRIKEN cDNA D930020B18 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7250 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location121641588-121693915 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121671831 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 158 (I158T)
Ref Sequence ENSEMBL: ENSMUSP00000118939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120642] [ENSMUST00000132744] [ENSMUST00000140802] [ENSMUST00000142501]
Predicted Effect probably damaging
Transcript: ENSMUST00000120642
AA Change: I361T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113963
Gene: ENSMUSG00000047642
AA Change: I361T

DomainStartEndE-ValueType
Pfam:DUF4551 11 617 3.2e-237 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000132744
AA Change: I185T

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000118274
Gene: ENSMUSG00000047642
AA Change: I185T

DomainStartEndE-ValueType
Pfam:DUF4551 1 148 3.6e-66 PFAM
Pfam:DUF4551 142 443 6.1e-145 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140802
SMART Domains Protein: ENSMUSP00000121976
Gene: ENSMUSG00000047642

DomainStartEndE-ValueType
Pfam:DUF4551 1 151 8.7e-68 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000142501
AA Change: I158T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118939
Gene: ENSMUSG00000047642
AA Change: I158T

DomainStartEndE-ValueType
Pfam:DUF4551 1 182 1.3e-74 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930480E11Rik G T X: 78,370,705 M345I probably benign Het
Actl7b T A 4: 56,741,035 M108L probably benign Het
Adgrf3 T A 5: 30,195,682 I934L probably damaging Het
Adprm A G 11: 67,041,624 V153A probably benign Het
Aif1l G A 2: 31,969,752 V109M probably damaging Het
Asphd1 T A 7: 126,946,770 E307V probably damaging Het
Ate1 T A 7: 130,519,971 probably benign Het
BC048403 T C 10: 121,745,471 S126P possibly damaging Het
BC067074 T G 13: 113,318,815 I465R Het
Borcs7 A G 19: 46,699,608 H64R probably damaging Het
C1qtnf1 A G 11: 118,448,350 *282W probably null Het
Cacna1c A G 6: 118,598,005 C1985R Het
Cacna1c A T 6: 118,696,451 V647E Het
Cacna1d A G 14: 30,075,151 S1497P probably damaging Het
Cacna1e T A 1: 154,700,489 I133F possibly damaging Het
Ccdc63 A T 5: 122,122,843 L206H probably damaging Het
Ccdc84 A G 9: 44,412,451 probably null Het
D430041D05Rik T C 2: 104,256,616 T672A possibly damaging Het
D630045J12Rik G T 6: 38,142,611 T1732K possibly damaging Het
Ddx52 G A 11: 83,944,566 G106D probably benign Het
Dock2 A G 11: 34,695,205 V550A probably benign Het
Dock2 C T 11: 34,695,293 D521N probably damaging Het
F13b T C 1: 139,516,489 probably null Het
Fchsd2 A G 7: 101,259,685 K431R possibly damaging Het
Fez1 C T 9: 36,867,794 R256C probably damaging Het
Gjd4 T A 18: 9,280,391 Q229L probably benign Het
Gpr45 T A 1: 43,032,371 I58N probably damaging Het
Gstm1 T A 3: 108,016,393 I99F probably damaging Het
Gtpbp8 T A 16: 44,743,862 T149S probably damaging Het
H2-Ab1 A G 17: 34,267,507 D180G probably damaging Het
Hdhd5 A G 6: 120,517,055 I188T possibly damaging Het
Hfm1 T C 5: 106,904,331 I300V probably benign Het
Hnrnpr T G 4: 136,332,435 D283E probably benign Het
Hsp90b1 T C 10: 86,691,708 E768G unknown Het
Kcna4 C A 2: 107,296,318 Q466K possibly damaging Het
Kcnk6 A G 7: 29,232,194 L97P probably benign Het
Kdelc2 C T 9: 53,390,521 Q158* probably null Het
Klf5 A G 14: 99,299,019 S9G probably benign Het
Kmt2c C A 5: 25,299,491 K3606N probably damaging Het
Kmt2c T C 5: 25,309,807 T3013A probably benign Het
Lancl1 A G 1: 67,009,299 Y207H possibly damaging Het
Lipe G C 7: 25,388,660 probably benign Het
Lrrc66 T A 5: 73,610,881 H239L probably benign Het
Ltbp2 C T 12: 84,787,392 W1441* probably null Het
Man2a1 T C 17: 64,636,588 S213P probably benign Het
Mapre2 C T 18: 23,858,062 A171V possibly damaging Het
Mdn1 T A 4: 32,695,427 D1155E probably damaging Het
Mki67 T C 7: 135,699,324 D1327G possibly damaging Het
Mx2 T C 16: 97,547,464 I279T probably damaging Het
Myo5c A G 9: 75,262,215 T441A probably damaging Het
Nlrp9a T G 7: 26,558,718 V587G possibly damaging Het
Npas2 A T 1: 39,338,107 T517S probably damaging Het
Npy1r T C 8: 66,705,060 S341P probably benign Het
Ntm A G 9: 29,411,692 W11R probably benign Het
Nxpe2 A T 9: 48,326,796 I53N possibly damaging Het
Olfr456 A G 6: 42,486,755 V146A probably benign Het
Olfr655 A T 7: 104,596,531 Y217N probably damaging Het
Olfr981 T A 9: 40,022,754 Y120* probably null Het
Onecut2 T C 18: 64,386,440 F443L probably benign Het
Parp2 T A 14: 50,817,344 V248E probably benign Het
Pcdh12 C A 18: 38,281,976 V699L probably benign Het
Pja2 G A 17: 64,309,456 P148L probably benign Het
Ppip5k2 T G 1: 97,745,462 D415A probably benign Het
Prss47 A G 13: 65,052,541 S74P probably benign Het
Ptprg G T 14: 12,166,767 M723I probably benign Het
Qsox2 A T 2: 26,228,432 I109N probably damaging Het
Ranbp3l A G 15: 9,011,980 E217G probably benign Het
Rgl2 C T 17: 33,933,429 R367W probably damaging Het
Rgs12 T A 5: 34,965,497 F208Y probably damaging Het
Rin3 C T 12: 102,368,634 T268I unknown Het
Rttn T A 18: 88,989,523 D427E probably benign Het
Samd13 G A 3: 146,646,324 P91S probably benign Het
Samd9l T C 6: 3,374,201 D1020G possibly damaging Het
Sec62 T G 3: 30,812,347 L201V possibly damaging Het
Setdb1 C T 3: 95,354,541 probably null Het
Sf3a3 A T 4: 124,722,915 T197S probably benign Het
Slc20a1 A T 2: 129,209,924 I618F possibly damaging Het
Slc38a3 A T 9: 107,656,666 M186K probably benign Het
Slc39a13 T C 2: 91,063,158 T319A probably benign Het
Slc44a4 T C 17: 34,918,544 probably null Het
St3gal1 A C 15: 67,106,729 D314E possibly damaging Het
Suclg1 A G 6: 73,271,091 N265S probably benign Het
Sult2b1 A T 7: 45,783,937 V2D unknown Het
Supv3l1 T A 10: 62,445,067 I182F probably damaging Het
Tcp11l2 T C 10: 84,587,241 probably null Het
Tenm2 C A 11: 36,072,798 L935F probably damaging Het
Tnks T A 8: 34,851,758 I790F probably damaging Het
Top2b C T 14: 16,420,411 T1274I probably benign Het
Tpi1 A T 6: 124,812,478 I178N probably damaging Het
Trav9d-1 A T 14: 52,792,696 S86C probably damaging Het
Treml2 A G 17: 48,309,127 E265G probably benign Het
Trpm7 A T 2: 126,826,765 S744T possibly damaging Het
Usp33 T A 3: 152,392,362 L909* probably null Het
Vcan A G 13: 89,721,686 I210T probably damaging Het
Vcan A T 13: 89,731,457 probably null Het
Vsig10l A T 7: 43,463,675 D17V probably benign Het
Zbtb7b T A 3: 89,379,669 T498S probably benign Het
Zfp366 T A 13: 99,229,568 H412Q probably damaging Het
Zfp53 C A 17: 21,509,578 D624E probably damaging Het
Zfp827 A T 8: 79,190,092 D432V Het
Zic1 T C 9: 91,364,975 T15A probably damaging Het
Zswim8 T C 14: 20,719,968 C1368R probably damaging Het
Other mutations in D930020B18Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:D930020B18Rik APN 10 121685584 missense probably damaging 1.00
IGL01669:D930020B18Rik APN 10 121683961 missense probably benign 0.03
IGL01793:D930020B18Rik APN 10 121671831 missense probably damaging 1.00
IGL01907:D930020B18Rik APN 10 121642010 missense probably damaging 0.97
IGL01981:D930020B18Rik APN 10 121692414 missense probably damaging 0.98
IGL02545:D930020B18Rik APN 10 121689933 missense possibly damaging 0.87
IGL03024:D930020B18Rik APN 10 121685622 splice site probably benign
R0022:D930020B18Rik UTSW 10 121671770 missense probably damaging 0.97
R0023:D930020B18Rik UTSW 10 121689821 missense probably damaging 0.99
R1872:D930020B18Rik UTSW 10 121641974 missense probably damaging 1.00
R2340:D930020B18Rik UTSW 10 121654836 missense probably damaging 1.00
R4074:D930020B18Rik UTSW 10 121656218 intron probably benign
R4990:D930020B18Rik UTSW 10 121654761 missense probably damaging 1.00
R4990:D930020B18Rik UTSW 10 121654762 missense probably damaging 1.00
R4992:D930020B18Rik UTSW 10 121654761 missense probably damaging 1.00
R4992:D930020B18Rik UTSW 10 121654762 missense probably damaging 1.00
R5096:D930020B18Rik UTSW 10 121667804 missense probably benign 0.19
R5677:D930020B18Rik UTSW 10 121669201 missense probably benign 0.00
R6401:D930020B18Rik UTSW 10 121641857 missense possibly damaging 0.95
R6481:D930020B18Rik UTSW 10 121661148 critical splice donor site probably null
R7070:D930020B18Rik UTSW 10 121641974 missense probably damaging 1.00
R7408:D930020B18Rik UTSW 10 121689834 missense probably damaging 1.00
R7446:D930020B18Rik UTSW 10 121667745 missense possibly damaging 0.94
X0021:D930020B18Rik UTSW 10 121641885 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GCCTCACTGCTTGTCAATGC -3'
(R):5'- CAACAGGACAGTTACATCTGGC -3'

Sequencing Primer
(F):5'- CACTGCTTGTCAATGCTAAGTCTAGG -3'
(R):5'- GGACAGTTACATCTGGCAAATAAAAG -3'
Posted On2019-06-26