Incidental Mutation 'R7250:Mx2'
ID563880
Institutional Source Beutler Lab
Gene Symbol Mx2
Ensembl Gene ENSMUSG00000023341
Gene NameMX dynamin-like GTPase 2
SynonymsMx-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.220) question?
Stock #R7250 (G1)
Quality Score179.009
Status Not validated
Chromosome16
Chromosomal Location97535308-97560900 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97547464 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 279 (I279T)
Ref Sequence ENSEMBL: ENSMUSP00000024112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024112] [ENSMUST00000188251] [ENSMUST00000190447]
Predicted Effect probably damaging
Transcript: ENSMUST00000024112
AA Change: I279T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000024112
Gene: ENSMUSG00000023341
AA Change: I279T

DomainStartEndE-ValueType
DYNc 39 282 2.71e-135 SMART
Blast:DYNc 426 539 4e-17 BLAST
GED 562 653 9.88e-30 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000188251
AA Change: I279T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141038
Gene: ENSMUSG00000023341
AA Change: I279T

DomainStartEndE-ValueType
DYNc 39 282 1.3e-137 SMART
low complexity region 592 603 N/A INTRINSIC
low complexity region 619 637 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000140229
Gene: ENSMUSG00000023341
AA Change: I279T

DomainStartEndE-ValueType
DYNc 39 282 1.3e-137 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype Mx1+ strains do not express MX2 protein. The Mx2 gene in BALB/cJ and CBA/J is interrupted by an open reading frame mutation. Mutagenesis correcting the frameshift permits Mx2 expression in 3T3 cells. This protein did not inhibit influenza virus but conferred resistance to vesicular stomatitis virus.
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930480E11Rik G T X: 78,370,705 M345I probably benign Het
Actl7b T A 4: 56,741,035 M108L probably benign Het
Adgrf3 T A 5: 30,195,682 I934L probably damaging Het
Adprm A G 11: 67,041,624 V153A probably benign Het
Aif1l G A 2: 31,969,752 V109M probably damaging Het
Asphd1 T A 7: 126,946,770 E307V probably damaging Het
Ate1 T A 7: 130,519,971 probably benign Het
BC048403 T C 10: 121,745,471 S126P possibly damaging Het
BC067074 T G 13: 113,318,815 I465R Het
Borcs7 A G 19: 46,699,608 H64R probably damaging Het
C1qtnf1 A G 11: 118,448,350 *282W probably null Het
Cacna1c A G 6: 118,598,005 C1985R Het
Cacna1c A T 6: 118,696,451 V647E Het
Cacna1d A G 14: 30,075,151 S1497P probably damaging Het
Cacna1e T A 1: 154,700,489 I133F possibly damaging Het
Ccdc63 A T 5: 122,122,843 L206H probably damaging Het
Ccdc84 A G 9: 44,412,451 probably null Het
D430041D05Rik T C 2: 104,256,616 T672A possibly damaging Het
D630045J12Rik G T 6: 38,142,611 T1732K possibly damaging Het
D930020B18Rik T C 10: 121,671,831 I158T probably damaging Het
Ddx52 G A 11: 83,944,566 G106D probably benign Het
Dock2 A G 11: 34,695,205 V550A probably benign Het
Dock2 C T 11: 34,695,293 D521N probably damaging Het
F13b T C 1: 139,516,489 probably null Het
Fchsd2 A G 7: 101,259,685 K431R possibly damaging Het
Fez1 C T 9: 36,867,794 R256C probably damaging Het
Gjd4 T A 18: 9,280,391 Q229L probably benign Het
Gpr45 T A 1: 43,032,371 I58N probably damaging Het
Gstm1 T A 3: 108,016,393 I99F probably damaging Het
Gtpbp8 T A 16: 44,743,862 T149S probably damaging Het
H2-Ab1 A G 17: 34,267,507 D180G probably damaging Het
Hdhd5 A G 6: 120,517,055 I188T possibly damaging Het
Hfm1 T C 5: 106,904,331 I300V probably benign Het
Hnrnpr T G 4: 136,332,435 D283E probably benign Het
Hsp90b1 T C 10: 86,691,708 E768G unknown Het
Kcna4 C A 2: 107,296,318 Q466K possibly damaging Het
Kcnk6 A G 7: 29,232,194 L97P probably benign Het
Kdelc2 C T 9: 53,390,521 Q158* probably null Het
Klf5 A G 14: 99,299,019 S9G probably benign Het
Kmt2c C A 5: 25,299,491 K3606N probably damaging Het
Kmt2c T C 5: 25,309,807 T3013A probably benign Het
Lancl1 A G 1: 67,009,299 Y207H possibly damaging Het
Lipe G C 7: 25,388,660 probably benign Het
Lrrc66 T A 5: 73,610,881 H239L probably benign Het
Ltbp2 C T 12: 84,787,392 W1441* probably null Het
Man2a1 T C 17: 64,636,588 S213P probably benign Het
Mapre2 C T 18: 23,858,062 A171V possibly damaging Het
Mdn1 T A 4: 32,695,427 D1155E probably damaging Het
Mki67 T C 7: 135,699,324 D1327G possibly damaging Het
Myo5c A G 9: 75,262,215 T441A probably damaging Het
Nlrp9a T G 7: 26,558,718 V587G possibly damaging Het
Npas2 A T 1: 39,338,107 T517S probably damaging Het
Npy1r T C 8: 66,705,060 S341P probably benign Het
Ntm A G 9: 29,411,692 W11R probably benign Het
Nxpe2 A T 9: 48,326,796 I53N possibly damaging Het
Olfr456 A G 6: 42,486,755 V146A probably benign Het
Olfr655 A T 7: 104,596,531 Y217N probably damaging Het
Olfr981 T A 9: 40,022,754 Y120* probably null Het
Onecut2 T C 18: 64,386,440 F443L probably benign Het
Parp2 T A 14: 50,817,344 V248E probably benign Het
Pcdh12 C A 18: 38,281,976 V699L probably benign Het
Pja2 G A 17: 64,309,456 P148L probably benign Het
Ppip5k2 T G 1: 97,745,462 D415A probably benign Het
Prss47 A G 13: 65,052,541 S74P probably benign Het
Ptprg G T 14: 12,166,767 M723I probably benign Het
Qsox2 A T 2: 26,228,432 I109N probably damaging Het
Ranbp3l A G 15: 9,011,980 E217G probably benign Het
Rgl2 C T 17: 33,933,429 R367W probably damaging Het
Rgs12 T A 5: 34,965,497 F208Y probably damaging Het
Rin3 C T 12: 102,368,634 T268I unknown Het
Rttn T A 18: 88,989,523 D427E probably benign Het
Samd13 G A 3: 146,646,324 P91S probably benign Het
Samd9l T C 6: 3,374,201 D1020G possibly damaging Het
Sec62 T G 3: 30,812,347 L201V possibly damaging Het
Setdb1 C T 3: 95,354,541 probably null Het
Sf3a3 A T 4: 124,722,915 T197S probably benign Het
Slc20a1 A T 2: 129,209,924 I618F possibly damaging Het
Slc38a3 A T 9: 107,656,666 M186K probably benign Het
Slc39a13 T C 2: 91,063,158 T319A probably benign Het
Slc44a4 T C 17: 34,918,544 probably null Het
St3gal1 A C 15: 67,106,729 D314E possibly damaging Het
Suclg1 A G 6: 73,271,091 N265S probably benign Het
Sult2b1 A T 7: 45,783,937 V2D unknown Het
Supv3l1 T A 10: 62,445,067 I182F probably damaging Het
Tcp11l2 T C 10: 84,587,241 probably null Het
Tenm2 C A 11: 36,072,798 L935F probably damaging Het
Tnks T A 8: 34,851,758 I790F probably damaging Het
Top2b C T 14: 16,420,411 T1274I probably benign Het
Tpi1 A T 6: 124,812,478 I178N probably damaging Het
Trav9d-1 A T 14: 52,792,696 S86C probably damaging Het
Treml2 A G 17: 48,309,127 E265G probably benign Het
Trpm7 A T 2: 126,826,765 S744T possibly damaging Het
Usp33 T A 3: 152,392,362 L909* probably null Het
Vcan A G 13: 89,721,686 I210T probably damaging Het
Vcan A T 13: 89,731,457 probably null Het
Vsig10l A T 7: 43,463,675 D17V probably benign Het
Zbtb7b T A 3: 89,379,669 T498S probably benign Het
Zfp366 T A 13: 99,229,568 H412Q probably damaging Het
Zfp53 C A 17: 21,509,578 D624E probably damaging Het
Zfp827 A T 8: 79,190,092 D432V Het
Zic1 T C 9: 91,364,975 T15A probably damaging Het
Zswim8 T C 14: 20,719,968 C1368R probably damaging Het
Other mutations in Mx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Mx2 APN 16 97544478 missense probably damaging 0.99
IGL01111:Mx2 APN 16 97558719 missense probably benign
IGL02103:Mx2 APN 16 97544595 missense probably damaging 1.00
IGL02678:Mx2 APN 16 97556120 critical splice donor site probably null
IGL03166:Mx2 APN 16 97546790 missense probably damaging 1.00
IGL03323:Mx2 APN 16 97546375 missense probably damaging 0.99
R0254:Mx2 UTSW 16 97556095 missense probably benign
R0699:Mx2 UTSW 16 97544553 missense probably damaging 1.00
R1180:Mx2 UTSW 16 97556009 missense probably damaging 1.00
R1702:Mx2 UTSW 16 97558683 missense probably benign
R1762:Mx2 UTSW 16 97538703 missense probably benign 0.09
R1922:Mx2 UTSW 16 97560351 missense probably benign 0.05
R2049:Mx2 UTSW 16 97538703 missense probably benign 0.09
R2141:Mx2 UTSW 16 97538703 missense probably benign 0.09
R2142:Mx2 UTSW 16 97538703 missense probably benign 0.09
R3010:Mx2 UTSW 16 97546799 missense possibly damaging 0.85
R4079:Mx2 UTSW 16 97556036 missense probably damaging 0.98
R4553:Mx2 UTSW 16 97552005 missense possibly damaging 0.52
R4594:Mx2 UTSW 16 97547432 nonsense probably null
R5211:Mx2 UTSW 16 97547433 missense probably damaging 1.00
R5785:Mx2 UTSW 16 97538704 missense possibly damaging 0.90
R6091:Mx2 UTSW 16 97546435 missense probably damaging 1.00
R7485:Mx2 UTSW 16 97545718 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TCATGTCTGCCTCAGCCAAG -3'
(R):5'- ATCATCCTCAGGCTGTTGCAC -3'

Sequencing Primer
(F):5'- CAGTGAGAGCTGAGCTTCCTG -3'
(R):5'- TCAGGCTGTTGCACACACAC -3'
Posted On2019-06-26