Incidental Mutation 'R7250:Slc44a4'
ID563884
Institutional Source Beutler Lab
Gene Symbol Slc44a4
Ensembl Gene ENSMUSG00000007034
Gene Namesolute carrier family 44, member 4
Synonyms2210409B01Rik, NG22
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7250 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location34914466-34930436 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 34918544 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000007249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007249] [ENSMUST00000013931] [ENSMUST00000078061] [ENSMUST00000097342] [ENSMUST00000114033] [ENSMUST00000137071] [ENSMUST00000169230]
Predicted Effect probably null
Transcript: ENSMUST00000007249
SMART Domains Protein: ENSMUSP00000007249
Gene: ENSMUSG00000007034

DomainStartEndE-ValueType
transmembrane domain 34 56 N/A INTRINSIC
low complexity region 93 102 N/A INTRINSIC
transmembrane domain 226 248 N/A INTRINSIC
transmembrane domain 250 272 N/A INTRINSIC
Pfam:Choline_transpo 311 674 5.4e-119 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000013931
SMART Domains Protein: ENSMUSP00000013931
Gene: ENSMUSG00000013787

DomainStartEndE-ValueType
low complexity region 2 47 N/A INTRINSIC
coiled coil region 336 385 N/A INTRINSIC
low complexity region 407 424 N/A INTRINSIC
low complexity region 604 627 N/A INTRINSIC
ANK 737 766 2.52e-6 SMART
ANK 770 799 1.19e-2 SMART
ANK 803 833 4.71e-6 SMART
ANK 837 866 2.9e-6 SMART
ANK 870 899 1e0 SMART
ANK 903 932 1.53e-5 SMART
PreSET 976 1075 2.44e-40 SMART
SET 1091 1214 4.08e-46 SMART
PostSET 1217 1233 2.84e-1 SMART
low complexity region 1245 1260 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000078061
SMART Domains Protein: ENSMUSP00000077208
Gene: ENSMUSG00000013787

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
coiled coil region 279 328 N/A INTRINSIC
low complexity region 350 367 N/A INTRINSIC
low complexity region 513 536 N/A INTRINSIC
ANK 646 675 2.52e-6 SMART
ANK 679 708 1.19e-2 SMART
ANK 712 742 4.71e-6 SMART
ANK 746 775 2.9e-6 SMART
ANK 779 808 1e0 SMART
ANK 812 841 1.53e-5 SMART
PreSET 885 984 2.44e-40 SMART
SET 1000 1123 4.08e-46 SMART
PostSET 1126 1142 2.84e-1 SMART
low complexity region 1154 1169 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097342
SMART Domains Protein: ENSMUSP00000094955
Gene: ENSMUSG00000013787

DomainStartEndE-ValueType
low complexity region 2 47 N/A INTRINSIC
coiled coil region 336 385 N/A INTRINSIC
low complexity region 407 424 N/A INTRINSIC
low complexity region 570 593 N/A INTRINSIC
ANK 703 732 2.52e-6 SMART
ANK 736 765 1.19e-2 SMART
ANK 769 799 4.71e-6 SMART
ANK 803 832 2.9e-6 SMART
ANK 836 865 1e0 SMART
ANK 869 898 1.53e-5 SMART
PreSET 942 1041 2.44e-40 SMART
SET 1057 1180 4.08e-46 SMART
PostSET 1183 1199 2.84e-1 SMART
low complexity region 1211 1226 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114033
SMART Domains Protein: ENSMUSP00000109667
Gene: ENSMUSG00000013787

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
coiled coil region 279 328 N/A INTRINSIC
low complexity region 350 367 N/A INTRINSIC
low complexity region 547 570 N/A INTRINSIC
ANK 680 709 2.52e-6 SMART
ANK 713 742 1.19e-2 SMART
ANK 746 776 4.71e-6 SMART
ANK 780 809 2.9e-6 SMART
ANK 813 842 1e0 SMART
ANK 846 875 1.53e-5 SMART
PreSET 919 1018 2.44e-40 SMART
SET 1034 1157 4.08e-46 SMART
PostSET 1160 1176 2.84e-1 SMART
low complexity region 1188 1203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137071
SMART Domains Protein: ENSMUSP00000134749
Gene: ENSMUSG00000013787

DomainStartEndE-ValueType
ANK 23 52 1.19e-2 SMART
ANK 56 86 4.71e-6 SMART
ANK 90 119 2.9e-6 SMART
low complexity region 143 154 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000169230
SMART Domains Protein: ENSMUSP00000132965
Gene: ENSMUSG00000007034

DomainStartEndE-ValueType
transmembrane domain 74 96 N/A INTRINSIC
transmembrane domain 98 120 N/A INTRINSIC
Pfam:Choline_transpo 157 524 3.9e-129 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may be a sodium-dependent transmembrane transport protein involved in the uptake of choline by cholinergic neurons. Defects in this gene can cause sialidosis, a lysosomal storage disease. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930480E11Rik G T X: 78,370,705 M345I probably benign Het
Actl7b T A 4: 56,741,035 M108L probably benign Het
Adgrf3 T A 5: 30,195,682 I934L probably damaging Het
Adprm A G 11: 67,041,624 V153A probably benign Het
Aif1l G A 2: 31,969,752 V109M probably damaging Het
Asphd1 T A 7: 126,946,770 E307V probably damaging Het
Ate1 T A 7: 130,519,971 probably benign Het
BC048403 T C 10: 121,745,471 S126P possibly damaging Het
BC067074 T G 13: 113,318,815 I465R Het
Borcs7 A G 19: 46,699,608 H64R probably damaging Het
C1qtnf1 A G 11: 118,448,350 *282W probably null Het
Cacna1c A G 6: 118,598,005 C1985R Het
Cacna1c A T 6: 118,696,451 V647E Het
Cacna1d A G 14: 30,075,151 S1497P probably damaging Het
Cacna1e T A 1: 154,700,489 I133F possibly damaging Het
Ccdc63 A T 5: 122,122,843 L206H probably damaging Het
Ccdc84 A G 9: 44,412,451 probably null Het
D430041D05Rik T C 2: 104,256,616 T672A possibly damaging Het
D630045J12Rik G T 6: 38,142,611 T1732K possibly damaging Het
D930020B18Rik T C 10: 121,671,831 I158T probably damaging Het
Ddx52 G A 11: 83,944,566 G106D probably benign Het
Dock2 A G 11: 34,695,205 V550A probably benign Het
Dock2 C T 11: 34,695,293 D521N probably damaging Het
F13b T C 1: 139,516,489 probably null Het
Fchsd2 A G 7: 101,259,685 K431R possibly damaging Het
Fez1 C T 9: 36,867,794 R256C probably damaging Het
Gjd4 T A 18: 9,280,391 Q229L probably benign Het
Gpr45 T A 1: 43,032,371 I58N probably damaging Het
Gstm1 T A 3: 108,016,393 I99F probably damaging Het
Gtpbp8 T A 16: 44,743,862 T149S probably damaging Het
H2-Ab1 A G 17: 34,267,507 D180G probably damaging Het
Hdhd5 A G 6: 120,517,055 I188T possibly damaging Het
Hfm1 T C 5: 106,904,331 I300V probably benign Het
Hnrnpr T G 4: 136,332,435 D283E probably benign Het
Hsp90b1 T C 10: 86,691,708 E768G unknown Het
Kcna4 C A 2: 107,296,318 Q466K possibly damaging Het
Kcnk6 A G 7: 29,232,194 L97P probably benign Het
Kdelc2 C T 9: 53,390,521 Q158* probably null Het
Klf5 A G 14: 99,299,019 S9G probably benign Het
Kmt2c C A 5: 25,299,491 K3606N probably damaging Het
Kmt2c T C 5: 25,309,807 T3013A probably benign Het
Lancl1 A G 1: 67,009,299 Y207H possibly damaging Het
Lipe G C 7: 25,388,660 probably benign Het
Lrrc66 T A 5: 73,610,881 H239L probably benign Het
Ltbp2 C T 12: 84,787,392 W1441* probably null Het
Man2a1 T C 17: 64,636,588 S213P probably benign Het
Mapre2 C T 18: 23,858,062 A171V possibly damaging Het
Mdn1 T A 4: 32,695,427 D1155E probably damaging Het
Mki67 T C 7: 135,699,324 D1327G possibly damaging Het
Mx2 T C 16: 97,547,464 I279T probably damaging Het
Myo5c A G 9: 75,262,215 T441A probably damaging Het
Nlrp9a T G 7: 26,558,718 V587G possibly damaging Het
Npas2 A T 1: 39,338,107 T517S probably damaging Het
Npy1r T C 8: 66,705,060 S341P probably benign Het
Ntm A G 9: 29,411,692 W11R probably benign Het
Nxpe2 A T 9: 48,326,796 I53N possibly damaging Het
Olfr456 A G 6: 42,486,755 V146A probably benign Het
Olfr655 A T 7: 104,596,531 Y217N probably damaging Het
Olfr981 T A 9: 40,022,754 Y120* probably null Het
Onecut2 T C 18: 64,386,440 F443L probably benign Het
Parp2 T A 14: 50,817,344 V248E probably benign Het
Pcdh12 C A 18: 38,281,976 V699L probably benign Het
Pja2 G A 17: 64,309,456 P148L probably benign Het
Ppip5k2 T G 1: 97,745,462 D415A probably benign Het
Prss47 A G 13: 65,052,541 S74P probably benign Het
Ptprg G T 14: 12,166,767 M723I probably benign Het
Qsox2 A T 2: 26,228,432 I109N probably damaging Het
Ranbp3l A G 15: 9,011,980 E217G probably benign Het
Rgl2 C T 17: 33,933,429 R367W probably damaging Het
Rgs12 T A 5: 34,965,497 F208Y probably damaging Het
Rin3 C T 12: 102,368,634 T268I unknown Het
Rttn T A 18: 88,989,523 D427E probably benign Het
Samd13 G A 3: 146,646,324 P91S probably benign Het
Samd9l T C 6: 3,374,201 D1020G possibly damaging Het
Sec62 T G 3: 30,812,347 L201V possibly damaging Het
Setdb1 C T 3: 95,354,541 probably null Het
Sf3a3 A T 4: 124,722,915 T197S probably benign Het
Slc20a1 A T 2: 129,209,924 I618F possibly damaging Het
Slc38a3 A T 9: 107,656,666 M186K probably benign Het
Slc39a13 T C 2: 91,063,158 T319A probably benign Het
St3gal1 A C 15: 67,106,729 D314E possibly damaging Het
Suclg1 A G 6: 73,271,091 N265S probably benign Het
Sult2b1 A T 7: 45,783,937 V2D unknown Het
Supv3l1 T A 10: 62,445,067 I182F probably damaging Het
Tcp11l2 T C 10: 84,587,241 probably null Het
Tenm2 C A 11: 36,072,798 L935F probably damaging Het
Tnks T A 8: 34,851,758 I790F probably damaging Het
Top2b C T 14: 16,420,411 T1274I probably benign Het
Tpi1 A T 6: 124,812,478 I178N probably damaging Het
Trav9d-1 A T 14: 52,792,696 S86C probably damaging Het
Treml2 A G 17: 48,309,127 E265G probably benign Het
Trpm7 A T 2: 126,826,765 S744T possibly damaging Het
Usp33 T A 3: 152,392,362 L909* probably null Het
Vcan A G 13: 89,721,686 I210T probably damaging Het
Vcan A T 13: 89,731,457 probably null Het
Vsig10l A T 7: 43,463,675 D17V probably benign Het
Zbtb7b T A 3: 89,379,669 T498S probably benign Het
Zfp366 T A 13: 99,229,568 H412Q probably damaging Het
Zfp53 C A 17: 21,509,578 D624E probably damaging Het
Zfp827 A T 8: 79,190,092 D432V Het
Zic1 T C 9: 91,364,975 T15A probably damaging Het
Zswim8 T C 14: 20,719,968 C1368R probably damaging Het
Other mutations in Slc44a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Slc44a4 APN 17 34930240 utr 3 prime probably benign
IGL01097:Slc44a4 APN 17 34921569 missense probably damaging 0.97
IGL01296:Slc44a4 APN 17 34921698 missense probably benign 0.39
IGL01606:Slc44a4 APN 17 34929018 missense probably damaging 1.00
IGL01759:Slc44a4 APN 17 34921243 missense probably benign 0.00
IGL02026:Slc44a4 APN 17 34921856 splice site probably benign
IGL02119:Slc44a4 APN 17 34928661 missense probably damaging 1.00
IGL02338:Slc44a4 APN 17 34923810 missense possibly damaging 0.90
IGL02383:Slc44a4 APN 17 34927710 missense probably benign 0.00
IGL02526:Slc44a4 APN 17 34928487 missense probably damaging 0.99
IGL02744:Slc44a4 APN 17 34927800 missense probably damaging 1.00
IGL02754:Slc44a4 APN 17 34921303 missense probably damaging 0.98
ANU74:Slc44a4 UTSW 17 34921578 missense probably damaging 1.00
PIT4142001:Slc44a4 UTSW 17 34921275 missense probably damaging 0.99
R0007:Slc44a4 UTSW 17 34921254 missense probably damaging 0.99
R0007:Slc44a4 UTSW 17 34921254 missense probably damaging 0.99
R0452:Slc44a4 UTSW 17 34928095 missense possibly damaging 0.82
R0894:Slc44a4 UTSW 17 34928490 missense possibly damaging 0.92
R1136:Slc44a4 UTSW 17 34928022 missense probably damaging 1.00
R1224:Slc44a4 UTSW 17 34921868 missense probably benign 0.18
R1779:Slc44a4 UTSW 17 34921925 missense probably damaging 1.00
R2679:Slc44a4 UTSW 17 34923423 splice site probably benign
R3499:Slc44a4 UTSW 17 34921680 missense probably benign 0.02
R3732:Slc44a4 UTSW 17 34921561 synonymous silent
R4084:Slc44a4 UTSW 17 34917347 missense probably damaging 1.00
R4197:Slc44a4 UTSW 17 34918252 missense probably benign 0.12
R4536:Slc44a4 UTSW 17 34923839 missense probably damaging 1.00
R4547:Slc44a4 UTSW 17 34927755 missense probably damaging 1.00
R5093:Slc44a4 UTSW 17 34921243 missense probably benign 0.00
R6005:Slc44a4 UTSW 17 34923454 missense possibly damaging 0.69
R6396:Slc44a4 UTSW 17 34928884 nonsense probably null
R6660:Slc44a4 UTSW 17 34930225 missense probably damaging 0.99
R6860:Slc44a4 UTSW 17 34921068 missense probably damaging 1.00
R6863:Slc44a4 UTSW 17 34923822 missense probably benign 0.41
R6947:Slc44a4 UTSW 17 34928068 missense probably null 1.00
R7297:Slc44a4 UTSW 17 34927912 missense probably damaging 0.98
R7425:Slc44a4 UTSW 17 34921691 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGAGAATGGCCTACAGTGCC -3'
(R):5'- TCCACTATCTGGGGATGGAG -3'

Sequencing Primer
(F):5'- TCAGAAGCCAGGACCTGC -3'
(R):5'- GCATCATAACTAAGACCATTATCACC -3'
Posted On2019-06-26