Incidental Mutation 'R7253:Ptpn13'
ID564062
Institutional Source Beutler Lab
Gene Symbol Ptpn13
Ensembl Gene ENSMUSG00000034573
Gene Nameprotein tyrosine phosphatase, non-receptor type 13
SynonymsPTPL1, Ptpri, PTP-BL
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R7253 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location103425192-103598303 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 103565284 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 1758 (E1758K)
Ref Sequence ENSEMBL: ENSMUSP00000048119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048957]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048957
AA Change: E1758K

PolyPhen 2 Score 0.680 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000048119
Gene: ENSMUSG00000034573
AA Change: E1758K

DomainStartEndE-ValueType
KIND 3 190 2.3e-80 SMART
Blast:B41 340 447 6e-34 BLAST
coiled coil region 460 487 N/A INTRINSIC
B41 561 774 3.3e-68 SMART
FERM_C 780 869 3.2e-35 SMART
low complexity region 1049 1058 N/A INTRINSIC
PDZ 1093 1170 7.6e-25 SMART
low complexity region 1224 1236 N/A INTRINSIC
low complexity region 1309 1322 N/A INTRINSIC
low complexity region 1331 1341 N/A INTRINSIC
PDZ 1365 1442 1.7e-24 SMART
low complexity region 1450 1468 N/A INTRINSIC
PDZ 1499 1579 3.5e-19 SMART
PDZ 1773 1845 1.2e-21 SMART
PDZ 1867 1942 1.6e-16 SMART
low complexity region 2123 2134 N/A INTRINSIC
PTPc 2179 2436 6.9e-113 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP is a large intracellular protein. It has a catalytic PTP domain at its C-terminus and two major structural domains: a region with five PDZ domains and a FERM domain that binds to plasma membrane and cytoskeletal elements. This PTP was found to interact with, and dephosphorylate, Fas receptor and IkappaBalpha through the PDZ domains. This suggests it has a role in Fas mediated programmed cell death. This PTP was also shown to interact with GTPase-activating protein, and thus may function as a regulator of Rho signaling pathways. Four alternatively spliced transcript variants, which encode distinct proteins, have been reported. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal T-helper cell differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A G 4: 39,451,391 H199R not run Het
Ak9 A G 10: 41,432,484 N1804S unknown Het
Akr1c21 C A 13: 4,577,140 T147N probably damaging Het
Aldh1a2 A G 9: 71,215,934 T30A probably benign Het
Alox15 T C 11: 70,345,898 D447G probably damaging Het
Amigo2 T C 15: 97,245,075 I489V probably benign Het
Ano9 A T 7: 141,107,437 Y322N probably damaging Het
Arhgap40 G T 2: 158,547,656 W583L probably benign Het
Atxn2 A G 5: 121,778,021 E430G probably damaging Het
B020004J07Rik A T 4: 101,835,528 V425E probably benign Het
Brip1 T C 11: 86,143,278 Y539C possibly damaging Het
C87436 T A 6: 86,465,808 L454Q probably damaging Het
Casp4 T G 9: 5,324,868 Y227D probably benign Het
Ccdc151 T C 9: 22,002,471 T2A probably damaging Het
Chd4 T A 6: 125,106,592 probably null Het
Chrna10 A G 7: 102,112,086 C433R probably benign Het
Cntln A T 4: 85,118,473 N214I probably damaging Het
Colec12 G A 18: 9,848,922 V367I probably damaging Het
Cyp46a1 T C 12: 108,351,996 I222T probably benign Het
Dagla A T 19: 10,262,581 probably null Het
Dcaf7 C A 11: 106,047,843 probably null Het
Dclk2 C T 3: 86,793,259 R638H probably damaging Het
E2f7 A G 10: 110,766,303 probably null Het
Fam184a G T 10: 53,698,805 T236K probably benign Het
Fam46a C A 9: 85,326,717 G18C probably benign Het
Glyctk T C 9: 106,155,462 T451A probably damaging Het
Hectd4 A G 5: 121,314,881 K484E possibly damaging Het
Hspbap1 G T 16: 35,817,230 C243F unknown Het
Hspg2 A C 4: 137,519,946 N1160T probably benign Het
Ighv5-8 C T 12: 113,655,108 L48F probably benign Het
Jazf1 C A 6: 52,777,652 E146D probably benign Het
Katnb1 C T 8: 95,095,497 Q284* probably null Het
Kctd18 G T 1: 57,961,956 Y213* probably null Het
Klk1b26 T C 7: 44,014,789 S23P possibly damaging Het
Krt88 T C 15: 101,450,511 L26P probably damaging Het
Lrrc8b G A 5: 105,481,656 V623I probably benign Het
Map3k4 T A 17: 12,272,068 M159L probably benign Het
Mast3 C A 8: 70,789,682 probably null Het
Mier1 G A 4: 103,139,347 probably null Het
Mrpl46 T C 7: 78,781,459 D117G probably damaging Het
Ms4a6b A G 19: 11,520,396 S20G probably benign Het
Mup10 A T 4: 60,582,078 M4K unknown Het
Nlrp5 C T 7: 23,417,391 A180V possibly damaging Het
Nlrx1 T A 9: 44,264,704 probably null Het
Olfr1195 T C 2: 88,683,625 T36A possibly damaging Het
Olfr313 T A 11: 58,817,540 C177* probably null Het
Olfr315 T C 11: 58,778,996 Y290H probably damaging Het
Olfr437 T C 6: 43,167,810 F251L probably damaging Het
Olfr612 C T 7: 103,538,788 A149T probably benign Het
Olfr992 A G 2: 85,399,639 I298T probably benign Het
Otud1 C A 2: 19,658,931 D290E probably damaging Het
Pank4 A G 4: 154,970,920 N249S probably benign Het
Pccb G T 9: 101,031,913 S84R probably benign Het
Pemt A T 11: 59,971,255 H194Q possibly damaging Het
Phtf2 A G 5: 20,765,858 I634T possibly damaging Het
Pias2 T G 18: 77,120,115 I232R probably damaging Het
Plce1 A G 19: 38,698,508 E620G probably damaging Het
Ptprq T A 10: 107,608,273 Q1490L probably benign Het
Ptx3 G T 3: 66,224,947 M296I probably benign Het
R3hdm2 C T 10: 127,481,775 P464L probably damaging Het
Rapgef1 A G 2: 29,699,721 E258G possibly damaging Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,915 probably benign Het
Senp8 T C 9: 59,737,195 N226S probably benign Het
Six5 C T 7: 19,094,976 R114C probably damaging Het
Slc10a1 T C 12: 80,958,184 T195A probably benign Het
Slpi G T 2: 164,355,547 Q51K probably benign Het
Smarca4 T C 9: 21,658,960 V753A probably benign Het
Tbc1d32 C A 10: 56,198,441 M225I probably benign Het
Tnfrsf21 G A 17: 43,037,667 V57I probably benign Het
Trim44 G T 2: 102,346,968 P336T possibly damaging Het
Txlnb A G 10: 17,827,885 I264V probably damaging Het
Wisp3 T G 10: 39,155,035 N164T probably benign Het
Xirp2 A C 2: 67,513,482 E2022D probably benign Het
Zfp975 A G 7: 42,661,612 *526R probably null Het
Zp1 A G 19: 10,916,569 L424P probably damaging Het
Other mutations in Ptpn13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ptpn13 APN 5 103551058 missense probably damaging 1.00
IGL00569:Ptpn13 APN 5 103591006 splice site probably benign
IGL00764:Ptpn13 APN 5 103597718 missense probably damaging 1.00
IGL00805:Ptpn13 APN 5 103554729 missense probably benign 0.33
IGL00922:Ptpn13 APN 5 103588088 missense probably damaging 1.00
IGL00959:Ptpn13 APN 5 103517571 critical splice donor site probably null
IGL01090:Ptpn13 APN 5 103541314 missense probably null 0.80
IGL01352:Ptpn13 APN 5 103486775 splice site probably null
IGL01510:Ptpn13 APN 5 103562300 missense probably damaging 1.00
IGL01515:Ptpn13 APN 5 103556113 missense probably benign 0.06
IGL01896:Ptpn13 APN 5 103501523 missense possibly damaging 0.78
IGL02094:Ptpn13 APN 5 103594617 missense probably damaging 1.00
IGL02561:Ptpn13 APN 5 103562291 missense probably damaging 1.00
IGL02562:Ptpn13 APN 5 103562291 missense probably damaging 1.00
IGL02567:Ptpn13 APN 5 103562291 missense probably damaging 1.00
IGL02604:Ptpn13 APN 5 103501903 missense probably benign 0.01
IGL02679:Ptpn13 APN 5 103569454 missense possibly damaging 0.55
IGL02981:Ptpn13 APN 5 103528804 missense probably damaging 1.00
IGL03131:Ptpn13 APN 5 103517559 missense probably benign
IGL03136:Ptpn13 APN 5 103543463 missense possibly damaging 0.49
IGL03163:Ptpn13 APN 5 103591346 missense probably damaging 1.00
IGL03271:Ptpn13 APN 5 103462148 missense probably damaging 1.00
IGL03297:Ptpn13 APN 5 103541077 missense probably benign 0.13
IGL03328:Ptpn13 APN 5 103516348 missense probably benign 0.00
IGL03343:Ptpn13 APN 5 103554950 missense possibly damaging 0.88
IGL02835:Ptpn13 UTSW 5 103560025 missense probably damaging 0.98
P0021:Ptpn13 UTSW 5 103528820 missense probably benign 0.39
R0017:Ptpn13 UTSW 5 103486772 critical splice donor site probably null
R0090:Ptpn13 UTSW 5 103569503 missense probably damaging 1.00
R0111:Ptpn13 UTSW 5 103580763 splice site probably benign
R0183:Ptpn13 UTSW 5 103516408 missense probably benign 0.00
R0230:Ptpn13 UTSW 5 103527131 missense probably damaging 1.00
R0302:Ptpn13 UTSW 5 103565225 missense probably benign
R0360:Ptpn13 UTSW 5 103533348 missense probably damaging 1.00
R0364:Ptpn13 UTSW 5 103533348 missense probably damaging 1.00
R0388:Ptpn13 UTSW 5 103555062 missense probably benign 0.31
R0504:Ptpn13 UTSW 5 103501496 missense possibly damaging 0.92
R0558:Ptpn13 UTSW 5 103529717 missense probably damaging 0.99
R0562:Ptpn13 UTSW 5 103516425 critical splice donor site probably null
R0568:Ptpn13 UTSW 5 103489765 missense probably damaging 1.00
R0609:Ptpn13 UTSW 5 103556145 missense probably benign
R0669:Ptpn13 UTSW 5 103556109 missense probably benign
R0739:Ptpn13 UTSW 5 103575132 missense probably benign
R1006:Ptpn13 UTSW 5 103586789 missense probably benign 0.04
R1164:Ptpn13 UTSW 5 103489773 missense probably damaging 1.00
R1274:Ptpn13 UTSW 5 103550260 missense probably damaging 0.98
R1501:Ptpn13 UTSW 5 103516364 missense probably benign 0.01
R1529:Ptpn13 UTSW 5 103564132 missense probably benign 0.00
R1533:Ptpn13 UTSW 5 103556178 nonsense probably null
R1613:Ptpn13 UTSW 5 103536871 missense possibly damaging 0.89
R1616:Ptpn13 UTSW 5 103565237 missense possibly damaging 0.49
R1830:Ptpn13 UTSW 5 103543459 missense probably benign 0.00
R1892:Ptpn13 UTSW 5 103501679 missense possibly damaging 0.92
R1907:Ptpn13 UTSW 5 103580709 missense probably null 0.45
R2143:Ptpn13 UTSW 5 103556133 missense probably benign
R2145:Ptpn13 UTSW 5 103556133 missense probably benign
R2151:Ptpn13 UTSW 5 103525785 missense probably damaging 1.00
R2180:Ptpn13 UTSW 5 103569558 missense probably damaging 1.00
R2264:Ptpn13 UTSW 5 103489661 missense possibly damaging 0.96
R2313:Ptpn13 UTSW 5 103564161 missense probably damaging 1.00
R3522:Ptpn13 UTSW 5 103589854 splice site probably benign
R3773:Ptpn13 UTSW 5 103477121 missense probably damaging 1.00
R3924:Ptpn13 UTSW 5 103550741 splice site probably benign
R4289:Ptpn13 UTSW 5 103533285 missense probably damaging 1.00
R4348:Ptpn13 UTSW 5 103569726 missense probably damaging 1.00
R4385:Ptpn13 UTSW 5 103533407 splice site probably null
R4526:Ptpn13 UTSW 5 103501469 missense probably benign 0.32
R4557:Ptpn13 UTSW 5 103541110 missense probably damaging 1.00
R4596:Ptpn13 UTSW 5 103523692 missense probably benign 0.06
R4632:Ptpn13 UTSW 5 103569860 missense possibly damaging 0.46
R4727:Ptpn13 UTSW 5 103569855 missense probably benign
R4780:Ptpn13 UTSW 5 103586773 missense probably benign 0.04
R4793:Ptpn13 UTSW 5 103582778 critical splice donor site probably null
R4812:Ptpn13 UTSW 5 103523615 missense probably benign 0.00
R4939:Ptpn13 UTSW 5 103517469 intron probably null
R4951:Ptpn13 UTSW 5 103588046 missense probably benign 0.00
R5052:Ptpn13 UTSW 5 103561980 missense probably damaging 1.00
R5148:Ptpn13 UTSW 5 103492232 missense probably damaging 1.00
R5309:Ptpn13 UTSW 5 103541053 missense probably damaging 1.00
R5521:Ptpn13 UTSW 5 103501428 missense probably benign 0.03
R5545:Ptpn13 UTSW 5 103561964 missense probably damaging 1.00
R5696:Ptpn13 UTSW 5 103554759 missense probably benign 0.20
R5735:Ptpn13 UTSW 5 103554820 missense probably benign 0.03
R5815:Ptpn13 UTSW 5 103597690 splice site probably null
R5876:Ptpn13 UTSW 5 103476960 missense probably damaging 1.00
R5878:Ptpn13 UTSW 5 103477118 missense possibly damaging 0.89
R6366:Ptpn13 UTSW 5 103551053 missense probably damaging 1.00
R6455:Ptpn13 UTSW 5 103541284 missense probably benign 0.00
R6492:Ptpn13 UTSW 5 103501612 missense probably benign 0.02
R6709:Ptpn13 UTSW 5 103586756 missense probably benign 0.18
R6759:Ptpn13 UTSW 5 103565255 missense possibly damaging 0.49
R6944:Ptpn13 UTSW 5 103476991 missense probably null 1.00
R7079:Ptpn13 UTSW 5 103501886 missense probably benign 0.00
R7254:Ptpn13 UTSW 5 103594636 missense probably damaging 1.00
R7391:Ptpn13 UTSW 5 103540981 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCTGTGTTCTAAATATTGGCCC -3'
(R):5'- GTCCCCTAATTTCTCACCAGGG -3'

Sequencing Primer
(F):5'- TGGCCCTGAAATGTATCCACAAGTAG -3'
(R):5'- TTTCTCACCAGGGAAACATCAGAGAG -3'
Posted On2019-06-26