Incidental Mutation 'R7253:Glyctk'
ID564087
Institutional Source Beutler Lab
Gene Symbol Glyctk
Ensembl Gene ENSMUSG00000020258
Gene Nameglycerate kinase
Synonyms6230410P16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7253 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location106152857-106158138 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106155462 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 451 (T451A)
Ref Sequence ENSEMBL: ENSMUSP00000047761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036382] [ENSMUST00000112543] [ENSMUST00000159809] [ENSMUST00000162562] [ENSMUST00000217417]
Predicted Effect probably damaging
Transcript: ENSMUST00000036382
AA Change: T451A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047761
Gene: ENSMUSG00000020258
AA Change: T451A

DomainStartEndE-ValueType
Pfam:DUF4147 36 291 1.9e-84 PFAM
low complexity region 363 383 N/A INTRINSIC
Pfam:MOFRL 401 514 3.7e-38 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112543
AA Change: T451A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108162
Gene: ENSMUSG00000020258
AA Change: T451A

DomainStartEndE-ValueType
Pfam:DUF4147 37 290 1.6e-86 PFAM
low complexity region 363 383 N/A INTRINSIC
Pfam:MOFRL 402 514 7.6e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159809
SMART Domains Protein: ENSMUSP00000125369
Gene: ENSMUSG00000020258

DomainStartEndE-ValueType
Pfam:DUF4147 36 92 8.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162562
SMART Domains Protein: ENSMUSP00000125392
Gene: ENSMUSG00000020258

DomainStartEndE-ValueType
Pfam:DUF4147 36 124 6.4e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217417
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the glycerate kinase type-2 family. The encoded enzyme catalyzes the phosphorylation of (R)-glycerate and may be involved in serine degradation and fructose metabolism. Decreased activity of the encoded enzyme may be associated with the disease D-glyceric aciduria. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A G 4: 39,451,391 H199R not run Het
Ak9 A G 10: 41,432,484 N1804S unknown Het
Akr1c21 C A 13: 4,577,140 T147N probably damaging Het
Aldh1a2 A G 9: 71,215,934 T30A probably benign Het
Alox15 T C 11: 70,345,898 D447G probably damaging Het
Amigo2 T C 15: 97,245,075 I489V probably benign Het
Ano9 A T 7: 141,107,437 Y322N probably damaging Het
Arhgap40 G T 2: 158,547,656 W583L probably benign Het
Atxn2 A G 5: 121,778,021 E430G probably damaging Het
B020004J07Rik A T 4: 101,835,528 V425E probably benign Het
Brip1 T C 11: 86,143,278 Y539C possibly damaging Het
C87436 T A 6: 86,465,808 L454Q probably damaging Het
Casp4 T G 9: 5,324,868 Y227D probably benign Het
Ccdc151 T C 9: 22,002,471 T2A probably damaging Het
Chd4 T A 6: 125,106,592 probably null Het
Chrna10 A G 7: 102,112,086 C433R probably benign Het
Cntln A T 4: 85,118,473 N214I probably damaging Het
Colec12 G A 18: 9,848,922 V367I probably damaging Het
Cyp46a1 T C 12: 108,351,996 I222T probably benign Het
Dagla A T 19: 10,262,581 probably null Het
Dcaf7 C A 11: 106,047,843 probably null Het
Dclk2 C T 3: 86,793,259 R638H probably damaging Het
E2f7 A G 10: 110,766,303 probably null Het
Fam184a G T 10: 53,698,805 T236K probably benign Het
Fam46a C A 9: 85,326,717 G18C probably benign Het
Hectd4 A G 5: 121,314,881 K484E possibly damaging Het
Hspbap1 G T 16: 35,817,230 C243F unknown Het
Hspg2 A C 4: 137,519,946 N1160T probably benign Het
Ighv5-8 C T 12: 113,655,108 L48F probably benign Het
Jazf1 C A 6: 52,777,652 E146D probably benign Het
Katnb1 C T 8: 95,095,497 Q284* probably null Het
Kctd18 G T 1: 57,961,956 Y213* probably null Het
Klk1b26 T C 7: 44,014,789 S23P possibly damaging Het
Krt88 T C 15: 101,450,511 L26P probably damaging Het
Lrrc8b G A 5: 105,481,656 V623I probably benign Het
Map3k4 T A 17: 12,272,068 M159L probably benign Het
Mast3 C A 8: 70,789,682 probably null Het
Mier1 G A 4: 103,139,347 probably null Het
Mrpl46 T C 7: 78,781,459 D117G probably damaging Het
Ms4a6b A G 19: 11,520,396 S20G probably benign Het
Mup10 A T 4: 60,582,078 M4K unknown Het
Nlrp5 C T 7: 23,417,391 A180V possibly damaging Het
Nlrx1 T A 9: 44,264,704 probably null Het
Olfr1195 T C 2: 88,683,625 T36A possibly damaging Het
Olfr313 T A 11: 58,817,540 C177* probably null Het
Olfr315 T C 11: 58,778,996 Y290H probably damaging Het
Olfr437 T C 6: 43,167,810 F251L probably damaging Het
Olfr612 C T 7: 103,538,788 A149T probably benign Het
Olfr992 A G 2: 85,399,639 I298T probably benign Het
Otud1 C A 2: 19,658,931 D290E probably damaging Het
Pank4 A G 4: 154,970,920 N249S probably benign Het
Pccb G T 9: 101,031,913 S84R probably benign Het
Pemt A T 11: 59,971,255 H194Q possibly damaging Het
Phtf2 A G 5: 20,765,858 I634T possibly damaging Het
Pias2 T G 18: 77,120,115 I232R probably damaging Het
Plce1 A G 19: 38,698,508 E620G probably damaging Het
Ptpn13 G A 5: 103,565,284 E1758K possibly damaging Het
Ptprq T A 10: 107,608,273 Q1490L probably benign Het
Ptx3 G T 3: 66,224,947 M296I probably benign Het
R3hdm2 C T 10: 127,481,775 P464L probably damaging Het
Rapgef1 A G 2: 29,699,721 E258G possibly damaging Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,915 probably benign Het
Senp8 T C 9: 59,737,195 N226S probably benign Het
Six5 C T 7: 19,094,976 R114C probably damaging Het
Slc10a1 T C 12: 80,958,184 T195A probably benign Het
Slpi G T 2: 164,355,547 Q51K probably benign Het
Smarca4 T C 9: 21,658,960 V753A probably benign Het
Tbc1d32 C A 10: 56,198,441 M225I probably benign Het
Tnfrsf21 G A 17: 43,037,667 V57I probably benign Het
Trim44 G T 2: 102,346,968 P336T possibly damaging Het
Txlnb A G 10: 17,827,885 I264V probably damaging Het
Wisp3 T G 10: 39,155,035 N164T probably benign Het
Xirp2 A C 2: 67,513,482 E2022D probably benign Het
Zfp975 A G 7: 42,661,612 *526R probably null Het
Zp1 A G 19: 10,916,569 L424P probably damaging Het
Other mutations in Glyctk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01612:Glyctk APN 9 106155272 missense probably damaging 1.00
IGL02307:Glyctk APN 9 106155764 missense possibly damaging 0.64
IGL02581:Glyctk APN 9 106157781 missense probably benign
R0106:Glyctk UTSW 9 106155969 missense probably benign 0.00
R1465:Glyctk UTSW 9 106157607 missense probably damaging 1.00
R1465:Glyctk UTSW 9 106157607 missense probably damaging 1.00
R1652:Glyctk UTSW 9 106157157 missense probably damaging 1.00
R1859:Glyctk UTSW 9 106157532 missense probably benign 0.08
R1870:Glyctk UTSW 9 106155348 missense probably damaging 1.00
R1962:Glyctk UTSW 9 106157865 start codon destroyed probably null 0.99
R3875:Glyctk UTSW 9 106157621 missense probably damaging 1.00
R4167:Glyctk UTSW 9 106157762 missense probably benign 0.01
R4407:Glyctk UTSW 9 106157108 intron probably benign
R5860:Glyctk UTSW 9 106155707 missense possibly damaging 0.54
R6167:Glyctk UTSW 9 106156492 missense possibly damaging 0.75
R6240:Glyctk UTSW 9 106156262 intron probably null
X0004:Glyctk UTSW 9 106155719 missense probably benign
Predicted Primers PCR Primer
(F):5'- CACCATCACTGAGGATGAAGAATC -3'
(R):5'- CTCTGGAAGCGGTGGTAAAG -3'

Sequencing Primer
(F):5'- GGACATCCATAACATTGGTCCCTG -3'
(R):5'- GGCTAAAGGGCCGGTCTG -3'
Posted On2019-06-26