Incidental Mutation 'R0581:Ralgapb'
ID56414
Institutional Source Beutler Lab
Gene Symbol Ralgapb
Ensembl Gene ENSMUSG00000027652
Gene NameRal GTPase activating protein, beta subunit (non-catalytic)
SynonymsB230339M05Rik
MMRRC Submission 038771-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0581 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location158409848-158499253 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 158492961 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1043 (T1043A)
Ref Sequence ENSEMBL: ENSMUSP00000116481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046274] [ENSMUST00000109485] [ENSMUST00000109486] [ENSMUST00000141497]
Predicted Effect probably benign
Transcript: ENSMUST00000046274
AA Change: T1361A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000048430
Gene: ENSMUSG00000027652
AA Change: T1361A

DomainStartEndE-ValueType
low complexity region 166 178 N/A INTRINSIC
low complexity region 610 625 N/A INTRINSIC
low complexity region 775 788 N/A INTRINSIC
low complexity region 910 920 N/A INTRINSIC
low complexity region 1086 1097 N/A INTRINSIC
low complexity region 1309 1321 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109485
AA Change: T1377A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105111
Gene: ENSMUSG00000027652
AA Change: T1377A

DomainStartEndE-ValueType
low complexity region 166 178 N/A INTRINSIC
low complexity region 622 637 N/A INTRINSIC
low complexity region 791 804 N/A INTRINSIC
low complexity region 926 936 N/A INTRINSIC
low complexity region 1102 1113 N/A INTRINSIC
low complexity region 1325 1337 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109486
AA Change: T1365A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105112
Gene: ENSMUSG00000027652
AA Change: T1365A

DomainStartEndE-ValueType
low complexity region 166 178 N/A INTRINSIC
low complexity region 610 625 N/A INTRINSIC
low complexity region 779 792 N/A INTRINSIC
low complexity region 914 924 N/A INTRINSIC
low complexity region 1090 1101 N/A INTRINSIC
low complexity region 1313 1325 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141497
AA Change: T1043A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000116481
Gene: ENSMUSG00000027652
AA Change: T1043A

DomainStartEndE-ValueType
low complexity region 288 303 N/A INTRINSIC
low complexity region 457 470 N/A INTRINSIC
low complexity region 592 602 N/A INTRINSIC
low complexity region 768 779 N/A INTRINSIC
low complexity region 991 1003 N/A INTRINSIC
Meta Mutation Damage Score 0.194 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.3%
  • 20x: 93.7%
Validation Efficiency 95% (42/44)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 A G 5: 4,050,620 T2761A probably benign Het
Apold1 G A 6: 134,983,813 V77I probably benign Het
Atad2 T C 15: 58,126,664 T139A probably benign Het
Cacna1a A T 8: 84,601,936 I1668F possibly damaging Het
Ccer2 T A 7: 28,757,026 probably benign Het
Cyp2c54 T A 19: 40,047,555 T304S probably benign Het
Dpp4 T A 2: 62,356,676 M497L probably benign Het
Evpl T A 11: 116,229,490 I541L probably benign Het
Ggn A G 7: 29,172,304 T370A probably benign Het
Ghr A G 15: 3,388,634 probably benign Het
Gm6605 C A 7: 38,448,275 noncoding transcript Het
Gpr68 G C 12: 100,878,556 P243R probably damaging Het
Gtf3c2 G T 5: 31,159,518 Y720* probably null Het
Il2rb T A 15: 78,481,936 Y387F possibly damaging Het
Kcnu1 T A 8: 25,937,501 V282E probably damaging Het
Krt222 G A 11: 99,236,192 Q201* probably null Het
Lats1 A G 10: 7,702,941 T610A possibly damaging Het
Mroh2a GT GTT 1: 88,256,166 probably null Het
Myh7 T C 14: 54,985,496 I751V probably benign Het
Mypn A G 10: 63,162,244 I429T probably benign Het
Nemf A T 12: 69,322,271 D723E probably benign Het
Nlrp4b T C 7: 10,714,530 L220P probably damaging Het
Npr3 T A 15: 11,851,450 D418V probably damaging Het
Nsd3 A G 8: 25,710,691 N1270S probably damaging Het
Olfr123 A G 17: 37,796,102 I219M probably damaging Het
Olfr344 T C 2: 36,568,822 S75P probably damaging Het
Otogl G A 10: 107,789,040 T1579I possibly damaging Het
Pkp2 T A 16: 16,269,783 probably benign Het
Psd3 T C 8: 67,720,946 Y301C probably damaging Het
Psmb4 T C 3: 94,886,168 H134R probably damaging Het
Sec14l5 T A 16: 5,178,485 probably null Het
Serpina12 T A 12: 104,031,140 Q374L probably damaging Het
Serpinb10 C T 1: 107,546,962 R362* probably null Het
Sorcs1 T A 19: 50,252,701 I416F possibly damaging Het
Sparcl1 T C 5: 104,093,312 D82G probably damaging Het
Stat6 A T 10: 127,648,116 Q89L probably damaging Het
Tat A G 8: 109,991,638 T52A possibly damaging Het
Yipf7 T A 5: 69,521,063 I128F probably benign Het
Zfp112 T A 7: 24,125,863 C419S probably damaging Het
Zzef1 A G 11: 72,851,900 I769V probably benign Het
Other mutations in Ralgapb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Ralgapb APN 2 158420856 missense probably damaging 1.00
IGL00534:Ralgapb APN 2 158430500 missense possibly damaging 0.72
IGL01362:Ralgapb APN 2 158435465 missense probably damaging 1.00
IGL01653:Ralgapb APN 2 158462159 missense possibly damaging 0.94
IGL01704:Ralgapb APN 2 158420875 missense possibly damaging 0.92
IGL02000:Ralgapb APN 2 158454114 splice site probably benign
IGL02169:Ralgapb APN 2 158426204 missense probably damaging 1.00
IGL02516:Ralgapb APN 2 158465815 splice site probably benign
IGL02548:Ralgapb APN 2 158444665 missense probably damaging 0.97
IGL02550:Ralgapb APN 2 158448411 missense probably damaging 1.00
IGL02653:Ralgapb APN 2 158443309 missense probably damaging 1.00
IGL02744:Ralgapb APN 2 158446151 missense probably damaging 1.00
IGL02804:Ralgapb APN 2 158426284 missense possibly damaging 0.78
IGL02937:Ralgapb APN 2 158493016 splice site probably null
IGL02993:Ralgapb APN 2 158437394 missense possibly damaging 0.90
IGL03154:Ralgapb APN 2 158432866 missense probably damaging 1.00
IGL03204:Ralgapb APN 2 158465912 missense possibly damaging 0.67
IGL03347:Ralgapb APN 2 158465960 missense possibly damaging 0.67
PIT4142001:Ralgapb UTSW 2 158430422 missense probably benign 0.34
R0037:Ralgapb UTSW 2 158437411 missense probably damaging 1.00
R0037:Ralgapb UTSW 2 158437411 missense probably damaging 1.00
R0077:Ralgapb UTSW 2 158473249 missense probably damaging 1.00
R0629:Ralgapb UTSW 2 158439547 missense probably damaging 1.00
R0839:Ralgapb UTSW 2 158473283 critical splice donor site probably null
R1331:Ralgapb UTSW 2 158430533 missense probably damaging 1.00
R1468:Ralgapb UTSW 2 158462253 missense possibly damaging 0.95
R1468:Ralgapb UTSW 2 158462253 missense possibly damaging 0.95
R1540:Ralgapb UTSW 2 158465826 missense probably benign 0.00
R1572:Ralgapb UTSW 2 158446199 splice site probably benign
R1628:Ralgapb UTSW 2 158430463 missense probably benign 0.04
R1718:Ralgapb UTSW 2 158443280 nonsense probably null
R1777:Ralgapb UTSW 2 158462195 missense probably damaging 1.00
R1822:Ralgapb UTSW 2 158492452 missense probably damaging 0.99
R1903:Ralgapb UTSW 2 158495563 missense probably benign 0.04
R1909:Ralgapb UTSW 2 158444675 missense probably damaging 1.00
R2157:Ralgapb UTSW 2 158437472 missense probably benign 0.15
R4524:Ralgapb UTSW 2 158437306 missense probably benign 0.00
R4946:Ralgapb UTSW 2 158440967 missense probably damaging 1.00
R4975:Ralgapb UTSW 2 158435508 missense possibly damaging 0.66
R5014:Ralgapb UTSW 2 158495535 missense probably damaging 1.00
R5165:Ralgapb UTSW 2 158465912 missense possibly damaging 0.67
R5465:Ralgapb UTSW 2 158448405 missense possibly damaging 0.81
R5526:Ralgapb UTSW 2 158432785 missense probably damaging 1.00
R5566:Ralgapb UTSW 2 158494710 missense possibly damaging 0.90
R5949:Ralgapb UTSW 2 158454259 missense probably damaging 1.00
R6140:Ralgapb UTSW 2 158456572 missense probably damaging 1.00
R6175:Ralgapb UTSW 2 158446155 missense probably damaging 1.00
R6192:Ralgapb UTSW 2 158449447 intron probably null
R6364:Ralgapb UTSW 2 158462109 missense probably damaging 1.00
R6458:Ralgapb UTSW 2 158444620 missense probably damaging 1.00
R6746:Ralgapb UTSW 2 158476136 missense probably damaging 1.00
R6782:Ralgapb UTSW 2 158436566 missense probably damaging 0.99
R6788:Ralgapb UTSW 2 158436566 missense probably damaging 0.99
R7017:Ralgapb UTSW 2 158448337 missense probably benign 0.19
R7108:Ralgapb UTSW 2 158492460 missense probably damaging 0.98
R7108:Ralgapb UTSW 2 158494662 missense probably damaging 1.00
R7236:Ralgapb UTSW 2 158440827 missense probably benign 0.34
R7454:Ralgapb UTSW 2 158432902 missense possibly damaging 0.94
R7485:Ralgapb UTSW 2 158443355 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- TCAGCCGAAGCACGTTATGAAAGG -3'
(R):5'- AGACTGAGACACTGACTGCGAGAC -3'

Sequencing Primer
(F):5'- AGCACAGACTGTGGACTTCT -3'
(R):5'- tgtcgtcagaggtcggag -3'
Posted On2013-07-11