Incidental Mutation 'R7256:Ccdc162'
ID564278
Institutional Source Beutler Lab
Gene Symbol Ccdc162
Ensembl Gene ENSMUSG00000075225
Gene Namecoiled-coil domain containing 162
Synonyms5033413D22Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R7256 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location41538846-41716634 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 41556001 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 1832 (A1832V)
Ref Sequence ENSEMBL: ENSMUSP00000140774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019955] [ENSMUST00000099932] [ENSMUST00000179614] [ENSMUST00000189488] [ENSMUST00000219054]
Predicted Effect probably damaging
Transcript: ENSMUST00000019955
AA Change: A40V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019955
Gene: ENSMUSG00000075225
AA Change: A40V

DomainStartEndE-ValueType
coiled coil region 1 37 N/A INTRINSIC
low complexity region 116 138 N/A INTRINSIC
coiled coil region 177 217 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000092852
Gene: ENSMUSG00000075225
AA Change: A182V

DomainStartEndE-ValueType
coiled coil region 140 179 N/A INTRINSIC
low complexity region 304 326 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099932
AA Change: A369V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097516
Gene: ENSMUSG00000075225
AA Change: A369V

DomainStartEndE-ValueType
coiled coil region 327 366 N/A INTRINSIC
low complexity region 490 512 N/A INTRINSIC
coiled coil region 551 607 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179614
AA Change: A559V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135966
Gene: ENSMUSG00000075225
AA Change: A559V

DomainStartEndE-ValueType
coiled coil region 517 556 N/A INTRINSIC
low complexity region 680 702 N/A INTRINSIC
coiled coil region 741 797 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000189488
AA Change: A1832V

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140774
Gene: ENSMUSG00000075225
AA Change: A1832V

DomainStartEndE-ValueType
low complexity region 328 347 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000219054
AA Change: A559V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts5 A G 16: 85,863,035 Y790H probably damaging Het
Bend3 A C 10: 43,493,671 S7R probably benign Het
Ccdc106 A G 7: 5,060,326 T277A probably damaging Het
Ccser1 A G 6: 61,311,867 E338G probably benign Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Cecr2 T C 6: 120,762,529 S1406P probably benign Het
Cep290 A G 10: 100,546,498 T208A probably damaging Het
Cep85l A C 10: 53,296,255 C569W probably damaging Het
Ces5a G A 8: 93,499,526 T527I probably benign Het
Clca2 T A 3: 145,090,847 I200F probably damaging Het
Cmas G A 6: 142,770,586 D251N probably damaging Het
Ctcfl G T 2: 173,118,475 A105E probably benign Het
Dclk2 C T 3: 86,793,259 R638H probably damaging Het
Dctn6 A T 8: 34,090,808 I170N probably damaging Het
Dnah2 T C 11: 69,431,094 Y3800C probably damaging Het
Dsg2 G A 18: 20,591,931 V465I possibly damaging Het
Dzip1 T C 14: 118,885,646 T646A probably benign Het
Etv4 T A 11: 101,784,325 probably null Het
Exoc3l2 T C 7: 19,484,703 V549A unknown Het
Ficd G T 5: 113,738,819 A352S probably damaging Het
Fry T G 5: 150,466,786 I179S Het
Galntl5 A G 5: 25,195,300 H109R probably benign Het
Garem1 C A 18: 21,148,754 G182W probably damaging Het
Gm10696 T C 3: 94,176,360 E48G probably benign Het
Gm13078 T A 4: 143,726,279 D93E probably benign Het
Gm5916 A T 9: 36,120,989 Y50N possibly damaging Het
Gtf2h2 A T 13: 100,479,201 F271I probably benign Het
Hivep2 G T 10: 14,129,101 S481I probably benign Het
Homez T A 14: 54,857,420 Q277L probably damaging Het
Igll1 A G 16: 16,861,093 S118P probably damaging Het
Kif5b A G 18: 6,225,340 V230A probably damaging Het
Ldlr T A 9: 21,745,744 V719E probably benign Het
Lsm7 G A 10: 80,853,731 R66W possibly damaging Het
Map3k13 T A 16: 21,892,238 D90E probably benign Het
Mmrn1 A G 6: 60,976,114 K460E probably damaging Het
Myh10 A C 11: 68,790,689 N1061H probably damaging Het
Nepn A G 10: 52,400,993 Q275R probably benign Het
Noc3l A T 19: 38,812,356 D227E probably benign Het
Nploc4 G T 11: 120,428,550 S61R probably benign Het
Nr4a2 T C 2: 57,112,369 Y24C probably damaging Het
Nup160 T A 2: 90,723,355 I1143N probably damaging Het
Olfr1097 A G 2: 86,890,612 S188P probably damaging Het
Olfr1234 A T 2: 89,362,494 Y312N probably benign Het
Olfr294 G T 7: 86,615,665 H327N probably benign Het
Olfr895 T A 9: 38,268,708 M57K probably damaging Het
Papola T A 12: 105,809,345 C204S probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pgap1 A T 1: 54,493,207 probably null Het
Pitrm1 A G 13: 6,556,597 H229R probably damaging Het
Plcl1 A G 1: 55,698,218 Q906R probably benign Het
Ppfia3 T C 7: 45,341,743 N1018S probably benign Het
Prkd1 A G 12: 50,388,342 V534A possibly damaging Het
Pygm A T 19: 6,385,896 I126F probably benign Het
Rag1 T C 2: 101,642,070 Y909C probably damaging Het
Rasgrf2 G A 13: 91,884,518 Q560* probably null Het
Rbp3 A T 14: 33,962,583 I1190F possibly damaging Het
Reln T C 5: 21,978,923 K1693E probably benign Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Rsph3a A G 17: 7,946,170 T121A probably benign Het
Rufy3 A G 5: 88,614,947 N112S possibly damaging Het
Ryr3 G A 2: 112,672,246 Q3548* probably null Het
Sardh A T 2: 27,218,812 V637D probably benign Het
Spata16 T C 3: 26,667,867 V179A probably benign Het
Tbc1d30 G A 10: 121,288,965 T319I probably damaging Het
Tlr2 T A 3: 83,837,606 Q390L possibly damaging Het
Vmn1r113 T A 7: 20,787,445 I54N probably damaging Het
Vmn1r223 A C 13: 23,249,866 Y210S probably damaging Het
Zbbx A T 3: 75,039,898 H670Q probably benign Het
Other mutations in Ccdc162
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Ccdc162 APN 10 41581339 missense probably benign 0.01
IGL01366:Ccdc162 APN 10 41580306 missense possibly damaging 0.49
IGL01924:Ccdc162 APN 10 41569887 missense probably damaging 1.00
IGL02504:Ccdc162 APN 10 41552388 missense probably damaging 1.00
IGL02678:Ccdc162 APN 10 41561155 missense probably damaging 0.99
IGL02955:Ccdc162 APN 10 41561127 missense probably damaging 1.00
beeswax UTSW 10 41561226 missense possibly damaging 0.57
honeycomb UTSW 10 41644641 missense probably benign 0.35
FR4304:Ccdc162 UTSW 10 41556121 missense possibly damaging 0.49
R0432:Ccdc162 UTSW 10 41541860 missense probably benign 0.01
R0585:Ccdc162 UTSW 10 41586379 missense probably benign 0.03
R0645:Ccdc162 UTSW 10 41586411 splice site probably benign
R0731:Ccdc162 UTSW 10 41579143 missense probably damaging 1.00
R1426:Ccdc162 UTSW 10 41553182 missense possibly damaging 0.89
R1447:Ccdc162 UTSW 10 41580247 missense probably damaging 1.00
R1712:Ccdc162 UTSW 10 41539431 missense probably benign 0.35
R2138:Ccdc162 UTSW 10 41581297 missense probably benign 0.15
R2351:Ccdc162 UTSW 10 41555972 critical splice donor site probably null
R2394:Ccdc162 UTSW 10 41569898 missense probably damaging 1.00
R2431:Ccdc162 UTSW 10 41569845 missense probably benign
R2571:Ccdc162 UTSW 10 41552397 missense probably damaging 1.00
R2873:Ccdc162 UTSW 10 41655099 missense possibly damaging 0.68
R2926:Ccdc162 UTSW 10 41561207 start gained probably benign
R2999:Ccdc162 UTSW 10 41580290 missense probably benign 0.00
R3412:Ccdc162 UTSW 10 41539549 splice site probably benign
R3712:Ccdc162 UTSW 10 41587379 missense probably benign
R3736:Ccdc162 UTSW 10 41589568 intron probably null
R4112:Ccdc162 UTSW 10 41656328 missense possibly damaging 0.77
R4557:Ccdc162 UTSW 10 41587388 missense probably benign 0.01
R4580:Ccdc162 UTSW 10 41561140 missense probably benign 0.02
R4685:Ccdc162 UTSW 10 41681686 missense possibly damaging 0.89
R4837:Ccdc162 UTSW 10 41673867 missense probably benign 0.00
R5155:Ccdc162 UTSW 10 41553580 splice site probably null
R5155:Ccdc162 UTSW 10 41579151 missense probably damaging 1.00
R5645:Ccdc162 UTSW 10 41552356 missense probably benign 0.06
R5656:Ccdc162 UTSW 10 41569934 missense probably benign 0.26
R5682:Ccdc162 UTSW 10 41556803 nonsense probably null
R5808:Ccdc162 UTSW 10 41655504 missense possibly damaging 0.62
R5909:Ccdc162 UTSW 10 41561115 missense probably damaging 1.00
R6000:Ccdc162 UTSW 10 41561163 missense possibly damaging 0.75
R6057:Ccdc162 UTSW 10 41634041 missense possibly damaging 0.72
R6211:Ccdc162 UTSW 10 41630145 nonsense probably null
R6264:Ccdc162 UTSW 10 41694468 missense probably benign 0.31
R6329:Ccdc162 UTSW 10 41663151 missense possibly damaging 0.76
R6349:Ccdc162 UTSW 10 41694400 missense probably damaging 0.97
R6398:Ccdc162 UTSW 10 41627149 missense probably damaging 1.00
R6453:Ccdc162 UTSW 10 41550825 missense probably damaging 1.00
R6602:Ccdc162 UTSW 10 41615980 missense probably benign 0.00
R6627:Ccdc162 UTSW 10 41663185 missense probably damaging 1.00
R6722:Ccdc162 UTSW 10 41644641 missense probably benign 0.35
R6750:Ccdc162 UTSW 10 41561226 missense possibly damaging 0.57
R6968:Ccdc162 UTSW 10 41673844 missense possibly damaging 0.55
R6970:Ccdc162 UTSW 10 41615958 missense probably benign 0.03
R6989:Ccdc162 UTSW 10 41581353 missense probably damaging 0.99
R7008:Ccdc162 UTSW 10 41552415 missense probably damaging 1.00
R7135:Ccdc162 UTSW 10 41673859 missense probably benign 0.00
R7139:Ccdc162 UTSW 10 41666721 missense possibly damaging 0.49
R7224:Ccdc162 UTSW 10 41561191 missense probably damaging 1.00
R7230:Ccdc162 UTSW 10 41678813 missense probably damaging 1.00
R7261:Ccdc162 UTSW 10 41561140 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GATGATTCTCTCTGTGGCAAATC -3'
(R):5'- AATCACTGCATTGCCAGCC -3'

Sequencing Primer
(F):5'- AGTGGCGCATGTCTATAATCCCAG -3'
(R):5'- GCCTCCCCTCATGGCATATATTCTG -3'
Posted On2019-06-26