Incidental Mutation 'R0581:Myh7'
ID56439
Institutional Source Beutler Lab
Gene Symbol Myh7
Ensembl Gene ENSMUSG00000053093
Gene Namemyosin, heavy polypeptide 7, cardiac muscle, beta
SynonymsMyhcb, Myhc-b, MyHC-I, B-MHC, MYH-beta/slow, beta-MHC
MMRRC Submission 038771-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.812) question?
Stock #R0581 (G1)
Quality Score179
Status Validated
Chromosome14
Chromosomal Location54970684-54994626 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54985496 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 751 (I751V)
Ref Sequence ENSEMBL: ENSMUSP00000126840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102803] [ENSMUST00000168485]
Predicted Effect probably benign
Transcript: ENSMUST00000102803
AA Change: I751V

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000099867
Gene: ENSMUSG00000053093
AA Change: I751V

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Myosin_N 34 73 3.8e-16 PFAM
MYSc 79 779 N/A SMART
IQ 780 802 2.5e-2 SMART
Pfam:Myosin_tail_1 843 1924 5.6e-168 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149852
Predicted Effect probably benign
Transcript: ENSMUST00000168485
AA Change: I751V

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000126840
Gene: ENSMUSG00000053093
AA Change: I751V

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Myosin_N 34 75 1.6e-17 PFAM
MYSc 79 779 N/A SMART
IQ 780 802 2.5e-2 SMART
PDB:2FXO|D 838 963 6e-53 PDB
Pfam:Myosin_tail_1 1068 1926 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228715
Meta Mutation Damage Score 0.244 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.3%
  • 20x: 93.7%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Muscle myosin is a hexameric protein containing 2 heavy chain subunits, 2 alkali light chain subunits, and 2 regulatory light chain subunits. This gene encodes the beta (or slow) heavy chain subunit of cardiac myosin. It is expressed predominantly in normal human ventricle. It is also expressed in skeletal muscle tissues rich in slow-twitch type I muscle fibers. Changes in the relative abundance of this protein and the alpha (or fast) heavy subunit of cardiac myosin correlate with the contractile velocity of cardiac muscle. Its expression is also altered during thyroid hormone depletion and hemodynamic overloading. Mutations in this gene are associated with familial hypertrophic cardiomyopathy, myosin storage myopathy, dilated cardiomyopathy, and Laing early-onset distal myopathy. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 A G 5: 4,050,620 T2761A probably benign Het
Apold1 G A 6: 134,983,813 V77I probably benign Het
Atad2 T C 15: 58,126,664 T139A probably benign Het
Cacna1a A T 8: 84,601,936 I1668F possibly damaging Het
Ccer2 T A 7: 28,757,026 probably benign Het
Cyp2c54 T A 19: 40,047,555 T304S probably benign Het
Dpp4 T A 2: 62,356,676 M497L probably benign Het
Evpl T A 11: 116,229,490 I541L probably benign Het
Ggn A G 7: 29,172,304 T370A probably benign Het
Ghr A G 15: 3,388,634 probably benign Het
Gm6605 C A 7: 38,448,275 noncoding transcript Het
Gpr68 G C 12: 100,878,556 P243R probably damaging Het
Gtf3c2 G T 5: 31,159,518 Y720* probably null Het
Il2rb T A 15: 78,481,936 Y387F possibly damaging Het
Kcnu1 T A 8: 25,937,501 V282E probably damaging Het
Krt222 G A 11: 99,236,192 Q201* probably null Het
Lats1 A G 10: 7,702,941 T610A possibly damaging Het
Mroh2a GT GTT 1: 88,256,166 probably null Het
Mypn A G 10: 63,162,244 I429T probably benign Het
Nemf A T 12: 69,322,271 D723E probably benign Het
Nlrp4b T C 7: 10,714,530 L220P probably damaging Het
Npr3 T A 15: 11,851,450 D418V probably damaging Het
Nsd3 A G 8: 25,710,691 N1270S probably damaging Het
Olfr123 A G 17: 37,796,102 I219M probably damaging Het
Olfr344 T C 2: 36,568,822 S75P probably damaging Het
Otogl G A 10: 107,789,040 T1579I possibly damaging Het
Pkp2 T A 16: 16,269,783 probably benign Het
Psd3 T C 8: 67,720,946 Y301C probably damaging Het
Psmb4 T C 3: 94,886,168 H134R probably damaging Het
Ralgapb A G 2: 158,492,961 T1043A probably benign Het
Sec14l5 T A 16: 5,178,485 probably null Het
Serpina12 T A 12: 104,031,140 Q374L probably damaging Het
Serpinb10 C T 1: 107,546,962 R362* probably null Het
Sorcs1 T A 19: 50,252,701 I416F possibly damaging Het
Sparcl1 T C 5: 104,093,312 D82G probably damaging Het
Stat6 A T 10: 127,648,116 Q89L probably damaging Het
Tat A G 8: 109,991,638 T52A possibly damaging Het
Yipf7 T A 5: 69,521,063 I128F probably benign Het
Zfp112 T A 7: 24,125,863 C419S probably damaging Het
Zzef1 A G 11: 72,851,900 I769V probably benign Het
Other mutations in Myh7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Myh7 APN 14 54987388 missense probably damaging 1.00
IGL01025:Myh7 APN 14 54979537 missense probably damaging 1.00
IGL01092:Myh7 APN 14 54971632 missense possibly damaging 0.91
IGL01384:Myh7 APN 14 54971459 missense probably damaging 1.00
IGL01457:Myh7 APN 14 54988879 missense possibly damaging 0.66
IGL01671:Myh7 APN 14 54972924 missense probably damaging 1.00
IGL01923:Myh7 APN 14 54985459 critical splice donor site probably null
IGL02183:Myh7 APN 14 54974731 missense probably benign
IGL02379:Myh7 APN 14 54979468 missense probably damaging 1.00
IGL02884:Myh7 APN 14 54992819 missense probably benign 0.26
IGL02898:Myh7 APN 14 54983740 missense probably damaging 1.00
IGL03027:Myh7 APN 14 54983550 missense probably damaging 1.00
IGL03061:Myh7 APN 14 54991204 unclassified probably benign
IGL03145:Myh7 APN 14 54983345 missense probably damaging 1.00
IGL03250:Myh7 APN 14 54992247 missense probably damaging 1.00
IGL03394:Myh7 APN 14 54975361 missense probably damaging 1.00
R0019:Myh7 UTSW 14 54983734 missense possibly damaging 0.91
R0030:Myh7 UTSW 14 54991970 missense probably benign 0.00
R0183:Myh7 UTSW 14 54978876 missense probably benign 0.02
R0230:Myh7 UTSW 14 54973933 missense probably benign 0.03
R0295:Myh7 UTSW 14 54984821 splice site probably benign
R0423:Myh7 UTSW 14 54979189 missense probably benign 0.06
R0537:Myh7 UTSW 14 54990799 missense possibly damaging 0.81
R0541:Myh7 UTSW 14 54974701 missense probably benign
R0786:Myh7 UTSW 14 54992873 start codon destroyed probably null
R0866:Myh7 UTSW 14 54973139 missense probably benign
R1068:Myh7 UTSW 14 54987319 missense possibly damaging 0.93
R1075:Myh7 UTSW 14 54987403 missense probably benign
R1124:Myh7 UTSW 14 54973870 missense possibly damaging 0.78
R1140:Myh7 UTSW 14 54972882 missense probably damaging 1.00
R1260:Myh7 UTSW 14 54988451 missense probably benign 0.00
R1653:Myh7 UTSW 14 54990789 missense probably benign 0.00
R1677:Myh7 UTSW 14 54987516 missense probably benign 0.17
R1760:Myh7 UTSW 14 54972713 missense probably damaging 1.00
R1838:Myh7 UTSW 14 54973180 missense possibly damaging 0.91
R1839:Myh7 UTSW 14 54973180 missense possibly damaging 0.91
R2483:Myh7 UTSW 14 54973381 missense probably damaging 0.99
R2566:Myh7 UTSW 14 54983242 missense probably damaging 1.00
R3623:Myh7 UTSW 14 54973381 missense probably damaging 0.99
R3916:Myh7 UTSW 14 54974046 missense probably damaging 0.97
R4236:Myh7 UTSW 14 54991118 missense probably benign 0.34
R4471:Myh7 UTSW 14 54991854 nonsense probably null
R4700:Myh7 UTSW 14 54988321 missense possibly damaging 0.85
R4805:Myh7 UTSW 14 54985133 missense probably benign 0.27
R4880:Myh7 UTSW 14 54978588 missense probably benign 0.18
R4975:Myh7 UTSW 14 54971671 missense probably damaging 1.00
R4982:Myh7 UTSW 14 54972767 missense probably damaging 0.98
R5004:Myh7 UTSW 14 54971683 missense probably damaging 0.99
R5107:Myh7 UTSW 14 54986424 intron probably benign
R5124:Myh7 UTSW 14 54985742 nonsense probably null
R5256:Myh7 UTSW 14 54979508 missense probably damaging 1.00
R5335:Myh7 UTSW 14 54986563 intron probably benign
R5581:Myh7 UTSW 14 54978954 missense probably benign 0.00
R5861:Myh7 UTSW 14 54988890 missense possibly damaging 0.89
R5957:Myh7 UTSW 14 54989078 missense probably damaging 1.00
R6027:Myh7 UTSW 14 54970802 missense probably benign 0.01
R6184:Myh7 UTSW 14 54988858 missense probably damaging 1.00
R6232:Myh7 UTSW 14 54989296 missense probably benign 0.00
R6268:Myh7 UTSW 14 54989284 missense probably benign 0.00
R6274:Myh7 UTSW 14 54979486 missense probably damaging 0.97
R6345:Myh7 UTSW 14 54983692 missense probably damaging 1.00
R6383:Myh7 UTSW 14 54988894 missense probably benign 0.00
R6641:Myh7 UTSW 14 54982280 missense probably benign 0.37
R6755:Myh7 UTSW 14 54992313 missense possibly damaging 0.71
R6952:Myh7 UTSW 14 54991740 missense probably damaging 1.00
R7025:Myh7 UTSW 14 54974644 nonsense probably null
R7201:Myh7 UTSW 14 54990945 missense possibly damaging 0.58
R7257:Myh7 UTSW 14 54972490 intron probably null
R7296:Myh7 UTSW 14 54990025 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TTGAACTCCATTCTGGAGAGCACAC -3'
(R):5'- GGGTCTATGGTGGCCCTGAAATTC -3'

Sequencing Primer
(F):5'- CATGTGTGTTAGGCACAACTAGG -3'
(R):5'- CTATAGGCAGAGCAGACCCC -3'
Posted On2013-07-11