Incidental Mutation 'R0581:Npr3'
ID56441
Institutional Source Beutler Lab
Gene Symbol Npr3
Ensembl Gene ENSMUSG00000022206
Gene Namenatriuretic peptide receptor 3
Synonymslongjohn, NPR-C, B430320C24Rik, Nppc receptor, lgj
MMRRC Submission 038771-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.577) question?
Stock #R0581 (G1)
Quality Score165
Status Validated
Chromosome15
Chromosomal Location11839896-11907287 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 11851450 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 418 (D418V)
Ref Sequence ENSEMBL: ENSMUSP00000066737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066529] [ENSMUST00000228489] [ENSMUST00000228603]
Predicted Effect probably damaging
Transcript: ENSMUST00000066529
AA Change: D418V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000066737
Gene: ENSMUSG00000022206
AA Change: D418V

DomainStartEndE-ValueType
low complexity region 13 29 N/A INTRINSIC
Pfam:ANF_receptor 66 417 1e-59 PFAM
transmembrane domain 477 499 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226139
Predicted Effect probably damaging
Transcript: ENSMUST00000228489
AA Change: D164V

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000228603
AA Change: D418V

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Meta Mutation Damage Score 0.08 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.3%
  • 20x: 93.7%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of three natriuretic peptide receptors. Natriutetic peptides are small peptides which regulate blood volume and pressure, pulmonary hypertension, and cardiac function as well as some metabolic and growth processes. The product of this gene encodes a natriuretic peptide receptor responsible for clearing circulating and extracellular natriuretic peptides through endocytosis of the receptor. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous inactivation of this gene leads to partial postnatal lethality, altered blood homeostasis, polyuria, hypovolemia, hypotension, increased bone turnover, skeletal deformities and altered adipose morphology. Spontaneous and ENU-induced mutations cause a skeletal-overgrowth phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 A G 5: 4,050,620 T2761A probably benign Het
Apold1 G A 6: 134,983,813 V77I probably benign Het
Atad2 T C 15: 58,126,664 T139A probably benign Het
Cacna1a A T 8: 84,601,936 I1668F possibly damaging Het
Ccer2 T A 7: 28,757,026 probably benign Het
Cyp2c54 T A 19: 40,047,555 T304S probably benign Het
Dpp4 T A 2: 62,356,676 M497L probably benign Het
Evpl T A 11: 116,229,490 I541L probably benign Het
Ggn A G 7: 29,172,304 T370A probably benign Het
Ghr A G 15: 3,388,634 probably benign Het
Gm6605 C A 7: 38,448,275 noncoding transcript Het
Gpr68 G C 12: 100,878,556 P243R probably damaging Het
Gtf3c2 G T 5: 31,159,518 Y720* probably null Het
Il2rb T A 15: 78,481,936 Y387F possibly damaging Het
Kcnu1 T A 8: 25,937,501 V282E probably damaging Het
Krt222 G A 11: 99,236,192 Q201* probably null Het
Lats1 A G 10: 7,702,941 T610A possibly damaging Het
Mroh2a GT GTT 1: 88,256,166 probably null Het
Myh7 T C 14: 54,985,496 I751V probably benign Het
Mypn A G 10: 63,162,244 I429T probably benign Het
Nemf A T 12: 69,322,271 D723E probably benign Het
Nlrp4b T C 7: 10,714,530 L220P probably damaging Het
Nsd3 A G 8: 25,710,691 N1270S probably damaging Het
Olfr123 A G 17: 37,796,102 I219M probably damaging Het
Olfr344 T C 2: 36,568,822 S75P probably damaging Het
Otogl G A 10: 107,789,040 T1579I possibly damaging Het
Pkp2 T A 16: 16,269,783 probably benign Het
Psd3 T C 8: 67,720,946 Y301C probably damaging Het
Psmb4 T C 3: 94,886,168 H134R probably damaging Het
Ralgapb A G 2: 158,492,961 T1043A probably benign Het
Sec14l5 T A 16: 5,178,485 probably null Het
Serpina12 T A 12: 104,031,140 Q374L probably damaging Het
Serpinb10 C T 1: 107,546,962 R362* probably null Het
Sorcs1 T A 19: 50,252,701 I416F possibly damaging Het
Sparcl1 T C 5: 104,093,312 D82G probably damaging Het
Stat6 A T 10: 127,648,116 Q89L probably damaging Het
Tat A G 8: 109,991,638 T52A possibly damaging Het
Yipf7 T A 5: 69,521,063 I128F probably benign Het
Zfp112 T A 7: 24,125,863 C419S probably damaging Het
Zzef1 A G 11: 72,851,900 I769V probably benign Het
Other mutations in Npr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Npr3 APN 15 11895694 missense probably damaging 1.00
IGL01420:Npr3 APN 15 11858632 missense probably damaging 1.00
IGL01599:Npr3 APN 15 11895789 missense probably damaging 1.00
IGL01977:Npr3 APN 15 11858718 missense probably damaging 1.00
eel UTSW 15 11858647 missense probably damaging 0.99
R0607:Npr3 UTSW 15 11845282 missense probably benign 0.32
R1554:Npr3 UTSW 15 11848563 missense probably benign
R1779:Npr3 UTSW 15 11851486 missense probably damaging 1.00
R1793:Npr3 UTSW 15 11848579 missense probably benign 0.05
R1968:Npr3 UTSW 15 11904969 missense probably benign 0.31
R2379:Npr3 UTSW 15 11883363 missense probably damaging 0.99
R2883:Npr3 UTSW 15 11883324 missense possibly damaging 0.50
R3080:Npr3 UTSW 15 11905149 missense probably benign 0.01
R3745:Npr3 UTSW 15 11905491 missense probably damaging 1.00
R3803:Npr3 UTSW 15 11895790 missense probably damaging 1.00
R4166:Npr3 UTSW 15 11848513 missense probably benign 0.32
R4411:Npr3 UTSW 15 11905149 missense probably benign 0.01
R4412:Npr3 UTSW 15 11905149 missense probably benign 0.01
R4667:Npr3 UTSW 15 11905467 missense possibly damaging 0.58
R5209:Npr3 UTSW 15 11848603 missense possibly damaging 0.73
R5742:Npr3 UTSW 15 11883408 missense probably damaging 1.00
R6339:Npr3 UTSW 15 11845275 missense probably damaging 0.99
R6605:Npr3 UTSW 15 11905432 missense probably damaging 1.00
R6890:Npr3 UTSW 15 11883392 missense possibly damaging 0.89
S24628:Npr3 UTSW 15 11848563 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGAGGCAAGTAAGCTGCCCTTCC -3'
(R):5'- TCCCAGTCTGATGTGATTCCCTGTG -3'

Sequencing Primer
(F):5'- TTACCCAGTTCTGAGGAGAGACTC -3'
(R):5'- TCGTTTTCTTGGCAGGCA -3'
Posted On2013-07-11