Incidental Mutation 'R7259:Col9a1'
ID564449
Institutional Source Beutler Lab
Gene Symbol Col9a1
Ensembl Gene ENSMUSG00000026147
Gene Namecollagen, type IX, alpha 1
SynonymsCol9a-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R7259 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location24177610-24252684 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24185343 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 202 (E202G)
Ref Sequence ENSEMBL: ENSMUSP00000051579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054588]
Predicted Effect unknown
Transcript: ENSMUST00000054588
AA Change: E202G
SMART Domains Protein: ENSMUSP00000051579
Gene: ENSMUSG00000026147
AA Change: E202G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TSPN 50 244 5.73e-78 SMART
Pfam:Collagen 266 326 2e-11 PFAM
Pfam:Collagen 308 358 3.5e-9 PFAM
Pfam:Collagen 357 409 1.2e-8 PFAM
Pfam:Collagen 415 472 7.8e-11 PFAM
Pfam:Collagen 454 515 2.9e-11 PFAM
Pfam:Collagen 592 667 3.9e-8 PFAM
Pfam:Collagen 646 716 1.7e-9 PFAM
Pfam:Collagen 697 760 1.6e-10 PFAM
Pfam:Collagen 785 848 3.1e-11 PFAM
low complexity region 878 899 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three alpha chains of type IX collagen, which is a minor (5-20%) collagen component of hyaline cartilage. Type IX collagen is usually found in tissues containing type II collagen, a fibrillar collagen. Studies in knockout mice have shown that synthesis of the alpha 1 chain is essential for assembly of type IX collagen molecules, a heterotrimeric molecule, and that lack of type IX collagen is associated with early onset osteoarthritis. Mutations in this gene are associated with osteoarthritis in humans, with multiple epiphyseal dysplasia, 6, a form of chondrodysplasia, and with Stickler syndrome, a disease characterized by ophthalmic, orofacial, articular, and auditory defects. Two transcript variants that encode different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted mutation show no conspicuous skeletal abnormalities at birth but develop early-onset degenerative joint disease resembling osteoarthritis as well as progressive hearing loss; restoration and remodeling of trabecular bone is perturbed with minimal effects on cortical bone. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb2 A G 13: 8,570,252 Y258C probably benign Het
Aebp2 A G 6: 140,633,768 S244G probably benign Het
Agl A T 3: 116,784,581 Y495N probably damaging Het
Arhgap33 A G 7: 30,532,200 V120A probably damaging Het
Asb14 C T 14: 26,903,455 H256Y probably benign Het
Atp2a2 A G 5: 122,466,069 Y434H probably benign Het
Atrnl1 C T 19: 57,935,606 R1268* probably null Het
AW554918 A G 18: 25,289,849 probably null Het
Canx A G 11: 50,301,816 W324R probably damaging Het
Ccdc130 T C 8: 84,260,317 S184G probably damaging Het
Crh C A 3: 19,694,254 A75S possibly damaging Het
Ctnnal1 T A 4: 56,817,299 probably null Het
Dmrta2 T A 4: 109,981,907 S284T possibly damaging Het
Dock1 T C 7: 134,782,748 V680A probably damaging Het
Duox2 G A 2: 122,295,176 R317C probably damaging Het
Elmod2 A G 8: 83,321,509 L108P probably damaging Het
Exoc6b A G 6: 84,848,810 S540P probably benign Het
Fsip2 C T 2: 82,982,130 A2931V possibly damaging Het
Gipc2 A T 3: 152,128,056 I196K probably damaging Het
Gli2 A G 1: 118,836,534 S1296P probably benign Het
Gm21103 T A 14: 6,301,894 Q173L probably damaging Het
Gpatch1 A T 7: 35,287,121 probably null Het
Grm8 G A 6: 27,760,176 T385I probably null Het
Gtf2f1 C A 17: 57,004,562 D283Y probably damaging Het
Hcar1 T A 5: 123,879,212 T139S possibly damaging Het
Hcrtr1 T A 4: 130,135,818 T157S possibly damaging Het
Htra2 T G 6: 83,051,539 Q436P possibly damaging Het
Igkv1-133 A G 6: 67,725,538 D80G probably benign Het
Il21 C A 3: 37,227,654 probably null Het
Inpp5f T A 7: 128,669,957 C359S probably benign Het
Itgb6 A T 2: 60,650,011 I327N probably damaging Het
Itgbl1 A T 14: 123,843,904 T232S probably damaging Het
Kif1a T A 1: 93,073,810 K266* probably null Het
Mcm10 C A 2: 5,006,517 E214D probably benign Het
Mefv T A 16: 3,713,053 I522F probably damaging Het
Naaladl2 T A 3: 24,058,176 I581F possibly damaging Het
Naip6 A T 13: 100,304,355 Y306N probably damaging Het
Olfr1224-ps1 A C 2: 89,156,510 F222V probably benign Het
Olfr172 T C 16: 58,760,505 T224A possibly damaging Het
Olfr621-ps1 A T 7: 103,629,759 M67K probably damaging Het
Olfr780 T A 10: 129,321,794 M57K probably benign Het
Opn1sw T A 6: 29,378,912 H247L probably benign Het
Pbxip1 C A 3: 89,445,633 F195L probably benign Het
Pcdh12 A T 18: 38,281,624 F816Y probably benign Het
Pi4k2b C A 5: 52,753,245 N290K probably damaging Het
Pias2 T C 18: 77,152,720 S598P possibly damaging Het
Ppfia4 A G 1: 134,313,100 V835A probably damaging Het
Ptch1 T C 13: 63,573,294 K54E not run Het
Rnf213 A G 11: 119,452,575 I3589V Het
Scg2 T C 1: 79,436,985 Y7C probably benign Het
Sec16a A G 2: 26,441,592 V137A probably benign Het
Setdb1 G A 3: 95,339,913 T525I probably benign Het
Sgcg A T 14: 61,225,217 I227N probably benign Het
Slc35e4 A T 11: 3,912,530 probably null Het
Smarca2 C T 19: 26,654,464 Q560* probably null Het
Stk10 A G 11: 32,598,497 N355S probably benign Het
Supt6 A T 11: 78,207,616 D1716E probably damaging Het
Taok3 C T 5: 117,252,543 A523V probably benign Het
Tekt3 A G 11: 63,083,766 T304A possibly damaging Het
Ttc6 G T 12: 57,576,184 R123L probably benign Het
Tyw1 T A 5: 130,267,872 probably null Het
Ulk2 A G 11: 61,782,083 L895P probably damaging Het
Unc13c A T 9: 73,517,363 N1990K probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wipf1 A G 2: 73,435,081 S393P probably damaging Het
Other mutations in Col9a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Col9a1 APN 1 24185225 missense unknown
IGL00517:Col9a1 APN 1 24195534 intron probably benign
IGL01125:Col9a1 APN 1 24224645 critical splice acceptor site probably null
IGL01505:Col9a1 APN 1 24185124 missense unknown
IGL01583:Col9a1 APN 1 24185144 missense unknown
IGL01627:Col9a1 APN 1 24179608 critical splice donor site probably null
IGL01773:Col9a1 APN 1 24205066 missense probably benign 0.17
IGL02117:Col9a1 APN 1 24237493 nonsense probably null
IGL02192:Col9a1 APN 1 24221987 missense probably damaging 1.00
IGL02346:Col9a1 APN 1 24223609 missense probably damaging 0.96
IGL02383:Col9a1 APN 1 24185258 missense unknown
IGL02453:Col9a1 APN 1 24179357 missense unknown
IGL02553:Col9a1 APN 1 24221937 splice site probably benign
IGL03412:Col9a1 APN 1 24210427 critical splice donor site probably null
IGL03493:Col9a1 APN 1 24221570 splice site probably benign
ANU74:Col9a1 UTSW 1 24185328 missense unknown
R0076:Col9a1 UTSW 1 24237497 critical splice donor site probably null
R0076:Col9a1 UTSW 1 24237497 critical splice donor site probably null
R0090:Col9a1 UTSW 1 24223562 splice site probably null
R0356:Col9a1 UTSW 1 24185247 nonsense probably null
R0562:Col9a1 UTSW 1 24179279 splice site probably null
R0584:Col9a1 UTSW 1 24224490 splice site probably benign
R0708:Col9a1 UTSW 1 24237261 missense possibly damaging 0.92
R1342:Col9a1 UTSW 1 24223620 critical splice donor site probably null
R1445:Col9a1 UTSW 1 24237498 critical splice donor site probably null
R1791:Col9a1 UTSW 1 24185305 missense unknown
R1938:Col9a1 UTSW 1 24222473 missense probably damaging 1.00
R2214:Col9a1 UTSW 1 24208202 missense probably damaging 1.00
R2240:Col9a1 UTSW 1 24179501 missense unknown
R3757:Col9a1 UTSW 1 24232231 critical splice donor site probably null
R3891:Col9a1 UTSW 1 24185436 critical splice donor site probably null
R4249:Col9a1 UTSW 1 24244381 missense probably damaging 1.00
R4690:Col9a1 UTSW 1 24224706 splice site probably null
R4918:Col9a1 UTSW 1 24237258 missense possibly damaging 0.74
R4988:Col9a1 UTSW 1 24185192 missense unknown
R5144:Col9a1 UTSW 1 24239353 missense probably benign 0.08
R5327:Col9a1 UTSW 1 24195539 critical splice donor site probably null
R5511:Col9a1 UTSW 1 24179538 missense unknown
R5519:Col9a1 UTSW 1 24230254 splice site probably null
R5564:Col9a1 UTSW 1 24195355 start gained probably benign
R6076:Col9a1 UTSW 1 24195376 start gained probably benign
R6478:Col9a1 UTSW 1 24185405 missense unknown
R6886:Col9a1 UTSW 1 24185345 missense unknown
R7177:Col9a1 UTSW 1 24195417 missense unknown
R7268:Col9a1 UTSW 1 24207398 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CACTGGAACATTTGGCAGATCC -3'
(R):5'- AAAGATGTCTTGGGCGCTC -3'

Sequencing Primer
(F):5'- TGGCAGATCCAGGATTCCG -3'
(R):5'- GCTCACCTTTAGCCATGCAGG -3'
Posted On2019-06-26