Mutagenetix > Incidental Mutation

Incidental Mutation 'R0581:Sorcs1'

56448

Institutional Source

Beutler Lab

Gene Symbol

Sorcs1

Ensembl Gene

ENSMUSG00000043531

Gene Name

sortilin-related VPS10 domain containing receptor 1

Synonyms

MMRRC Submission

038771-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.094) question?

Stock #

R0581 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

50131737-50667084 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 50241139 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 416 (I416F)

Ref Sequence

ENSEMBL: ENSMUSP00000147591 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072685] [ENSMUST00000111756] [ENSMUST00000164039] [ENSMUST00000209413] [ENSMUST00000209783] [ENSMUST00000211008] [ENSMUST00000211687]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000072685
AA Change: I416F

PolyPhen 2 Score 0.378 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000072472
Gene: ENSMUSG00000043531
AA Change: I416F

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	94	113	N/A	INTRINSIC
VPS10	196	797	N/A	SMART
PKD	799	889	3.84e-1	SMART
PKD	897	975	8.63e-1	SMART
transmembrane domain	1098	1120	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111756
AA Change: I416F

PolyPhen 2 Score 0.698 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000107386
Gene: ENSMUSG00000043531
AA Change: I416F

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	94	113	N/A	INTRINSIC
VPS10	196	797	N/A	SMART
PKD	799	889	3.84e-1	SMART
PKD	897	975	8.63e-1	SMART
transmembrane domain	1098	1120	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000164039
AA Change: I416F

PolyPhen 2 Score 0.698 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000132615
Gene: ENSMUSG00000043531
AA Change: I416F

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	94	113	N/A	INTRINSIC
VPS10	196	797	N/A	SMART
PKD	799	889	3.84e-1	SMART
PKD	897	975	8.63e-1	SMART
transmembrane domain	1098	1120	N/A	INTRINSIC
low complexity region	1129	1142	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000168357

SMART Domains

Protein: ENSMUSP00000129190
Gene: ENSMUSG00000043531

Domain	Start	End	E-Value	Type
VPS10	1	320	6.99e-58	SMART
PKD	322	412	3.84e-1	SMART
PKD	420	498	8.63e-1	SMART
transmembrane domain	621	643	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000209413
AA Change: I416F

PolyPhen 2 Score 0.698 (Sensitivity: 0.86; Specificity: 0.92)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000209783
AA Change: I416F

PolyPhen 2 Score 0.525 (Sensitivity: 0.88; Specificity: 0.90)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000211008
AA Change: I416F

PolyPhen 2 Score 0.698 (Sensitivity: 0.86; Specificity: 0.92)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000211687
AA Change: I416F

PolyPhen 2 Score 0.698 (Sensitivity: 0.86; Specificity: 0.92)

Meta Mutation Damage Score

0.5349

Coding Region Coverage

1x: 99.7%
3x: 99.0%
10x: 97.3%
20x: 93.7%

Validation Efficiency

95% (42/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. Two of the five family members (sortilin and sortilin-related receptor) are synthesized as preproproteins; it is not yet known if this encoded protein is also a preproprotein. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Female mice homozygous for a null allele have abnormal amyloid beta levels in the brain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap9	A	G	5: 4,100,620 (GRCm39)	T2761A	probably benign	Het
Apold1	G	A	6: 134,960,776 (GRCm39)	V77I	probably benign	Het
Atad2	T	C	15: 57,990,060 (GRCm39)	T139A	probably benign	Het
Cacna1a	A	T	8: 85,328,565 (GRCm39)	I1668F	possibly damaging	Het
Ccer2	T	A	7: 28,456,451 (GRCm39)		probably benign	Het
Cyp2c54	T	A	19: 40,035,999 (GRCm39)	T304S	probably benign	Het
Dpp4	T	A	2: 62,187,020 (GRCm39)	M497L	probably benign	Het
Evpl	T	A	11: 116,120,316 (GRCm39)	I541L	probably benign	Het
Ggn	A	G	7: 28,871,729 (GRCm39)	T370A	probably benign	Het
Ghr	A	G	15: 3,418,116 (GRCm39)		probably benign	Het
Gm6605	C	A	7: 38,147,699 (GRCm39)		noncoding transcript	Het
Gpr68	G	C	12: 100,844,815 (GRCm39)	P243R	probably damaging	Het
Gtf3c2	G	T	5: 31,316,862 (GRCm39)	Y720*	probably null	Het
Il2rb	T	A	15: 78,366,136 (GRCm39)	Y387F	possibly damaging	Het
Kcnu1	T	A	8: 26,427,529 (GRCm39)	V282E	probably damaging	Het
Krt222	G	A	11: 99,127,018 (GRCm39)	Q201*	probably null	Het
Lats1	A	G	10: 7,578,705 (GRCm39)	T610A	possibly damaging	Het
Mroh2a	GT	GTT	1: 88,183,888 (GRCm39)		probably null	Het
Myh7	T	C	14: 55,222,953 (GRCm39)	I751V	probably benign	Het
Mypn	A	G	10: 62,998,023 (GRCm39)	I429T	probably benign	Het
Nemf	A	T	12: 69,369,045 (GRCm39)	D723E	probably benign	Het
Nlrp4b	T	C	7: 10,448,457 (GRCm39)	L220P	probably damaging	Het
Npr3	T	A	15: 11,851,536 (GRCm39)	D418V	probably damaging	Het
Nsd3	A	G	8: 26,200,718 (GRCm39)	N1270S	probably damaging	Het
Or1j15	T	C	2: 36,458,834 (GRCm39)	S75P	probably damaging	Het
Or2g1	A	G	17: 38,106,993 (GRCm39)	I219M	probably damaging	Het
Otogl	G	A	10: 107,624,901 (GRCm39)	T1579I	possibly damaging	Het
Pkp2	T	A	16: 16,087,647 (GRCm39)		probably benign	Het
Psd3	T	C	8: 68,173,598 (GRCm39)	Y301C	probably damaging	Het
Psmb4	T	C	3: 94,793,479 (GRCm39)	H134R	probably damaging	Het
Ralgapb	A	G	2: 158,334,881 (GRCm39)	T1043A	probably benign	Het
Sec14l5	T	A	16: 4,996,349 (GRCm39)		probably null	Het
Serpina12	T	A	12: 103,997,399 (GRCm39)	Q374L	probably damaging	Het
Serpinb10	C	T	1: 107,474,692 (GRCm39)	R362*	probably null	Het
Sparcl1	T	C	5: 104,241,178 (GRCm39)	D82G	probably damaging	Het
Stat6	A	T	10: 127,483,985 (GRCm39)	Q89L	probably damaging	Het
Tat	A	G	8: 110,718,270 (GRCm39)	T52A	possibly damaging	Het
Yipf7	T	A	5: 69,678,406 (GRCm39)	I128F	probably benign	Het
Zfp112	T	A	7: 23,825,288 (GRCm39)	C419S	probably damaging	Het
Zzef1	A	G	11: 72,742,726 (GRCm39)	I769V	probably benign	Het

Other mutations in Sorcs1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Sorcs1	APN	19	50,178,492 (GRCm39)	missense	probably damaging	1.00
IGL00983:Sorcs1	APN	19	50,164,566 (GRCm39)	missense	probably damaging	0.98
IGL01125:Sorcs1	APN	19	50,216,639 (GRCm39)	missense	probably damaging	1.00
IGL01320:Sorcs1	APN	19	50,276,517 (GRCm39)	splice site	probably benign
IGL01445:Sorcs1	APN	19	50,141,504 (GRCm39)	missense	probably damaging	1.00
IGL01682:Sorcs1	APN	19	50,169,944 (GRCm39)	missense	probably benign	0.43
IGL01799:Sorcs1	APN	19	50,218,647 (GRCm39)	critical splice donor site	probably null
IGL02044:Sorcs1	APN	19	50,276,597 (GRCm39)	splice site	probably benign
IGL02111:Sorcs1	APN	19	50,218,683 (GRCm39)	missense	probably benign	0.00
IGL02364:Sorcs1	APN	19	50,322,036 (GRCm39)	missense	probably damaging	1.00
IGL02378:Sorcs1	APN	19	50,171,109 (GRCm39)	nonsense	probably null
IGL02498:Sorcs1	APN	19	50,666,606 (GRCm39)	missense	probably benign
IGL02658:Sorcs1	APN	19	50,178,530 (GRCm39)	missense	probably damaging	1.00
IGL02939:Sorcs1	APN	19	50,666,368 (GRCm39)	nonsense	probably null
IGL02942:Sorcs1	APN	19	50,463,875 (GRCm39)	missense	probably damaging	1.00
IGL03057:Sorcs1	APN	19	50,248,194 (GRCm39)	nonsense	probably null
IGL03230:Sorcs1	APN	19	50,230,531 (GRCm39)	missense	probably damaging	1.00
P0033:Sorcs1	UTSW	19	50,141,345 (GRCm39)	missense	probably damaging	0.98
R0109:Sorcs1	UTSW	19	50,367,329 (GRCm39)	splice site	probably benign
R0115:Sorcs1	UTSW	19	50,624,891 (GRCm39)	intron	probably benign
R0242:Sorcs1	UTSW	19	50,216,659 (GRCm39)	missense	probably damaging	1.00
R0242:Sorcs1	UTSW	19	50,216,659 (GRCm39)	missense	probably damaging	1.00
R0325:Sorcs1	UTSW	19	50,301,480 (GRCm39)	splice site	probably null
R0481:Sorcs1	UTSW	19	50,624,891 (GRCm39)	intron	probably benign
R0669:Sorcs1	UTSW	19	50,230,380 (GRCm39)	splice site	probably benign
R0980:Sorcs1	UTSW	19	50,220,761 (GRCm39)	missense	probably benign	0.04
R1158:Sorcs1	UTSW	19	50,132,598 (GRCm39)	unclassified	probably benign
R1519:Sorcs1	UTSW	19	50,241,025 (GRCm39)	missense	probably benign	0.05
R1669:Sorcs1	UTSW	19	50,463,860 (GRCm39)	missense	probably damaging	0.99
R1779:Sorcs1	UTSW	19	50,163,481 (GRCm39)	splice site	probably benign
R1783:Sorcs1	UTSW	19	50,216,747 (GRCm39)	critical splice acceptor site	probably null
R1927:Sorcs1	UTSW	19	50,210,633 (GRCm39)	missense	probably damaging	1.00
R1935:Sorcs1	UTSW	19	50,221,082 (GRCm39)	missense	probably damaging	0.96
R1936:Sorcs1	UTSW	19	50,221,082 (GRCm39)	missense	probably damaging	0.96
R2109:Sorcs1	UTSW	19	50,666,630 (GRCm39)	missense	probably benign
R2206:Sorcs1	UTSW	19	50,218,655 (GRCm39)	missense	possibly damaging	0.81
R2207:Sorcs1	UTSW	19	50,218,655 (GRCm39)	missense	possibly damaging	0.81
R3031:Sorcs1	UTSW	19	50,213,613 (GRCm39)	missense	probably damaging	0.98
R3032:Sorcs1	UTSW	19	50,213,613 (GRCm39)	missense	probably damaging	0.98
R3107:Sorcs1	UTSW	19	50,199,088 (GRCm39)	missense	possibly damaging	0.83
R3508:Sorcs1	UTSW	19	50,213,613 (GRCm39)	missense	probably damaging	0.98
R3738:Sorcs1	UTSW	19	50,139,659 (GRCm39)	missense	probably benign	0.03
R4127:Sorcs1	UTSW	19	50,210,597 (GRCm39)	missense	probably benign	0.29
R4212:Sorcs1	UTSW	19	50,213,613 (GRCm39)	missense	probably damaging	0.98
R4213:Sorcs1	UTSW	19	50,213,613 (GRCm39)	missense	probably damaging	0.98
R4385:Sorcs1	UTSW	19	50,178,599 (GRCm39)	missense	probably benign	0.01
R4424:Sorcs1	UTSW	19	50,367,379 (GRCm39)	missense	probably damaging	0.97
R4603:Sorcs1	UTSW	19	50,301,402 (GRCm39)	critical splice donor site	probably null
R4679:Sorcs1	UTSW	19	50,171,107 (GRCm39)	missense	probably benign
R4780:Sorcs1	UTSW	19	50,132,419 (GRCm39)	unclassified	probably benign
R4781:Sorcs1	UTSW	19	50,171,119 (GRCm39)	missense	probably damaging	1.00
R4823:Sorcs1	UTSW	19	50,218,740 (GRCm39)	missense	possibly damaging	0.87
R4823:Sorcs1	UTSW	19	50,666,578 (GRCm39)	missense	possibly damaging	0.92
R4883:Sorcs1	UTSW	19	50,220,741 (GRCm39)	missense	probably benign	0.00
R5091:Sorcs1	UTSW	19	50,248,190 (GRCm39)	critical splice donor site	probably null
R5105:Sorcs1	UTSW	19	50,213,579 (GRCm39)	missense	possibly damaging	0.57
R5437:Sorcs1	UTSW	19	50,241,040 (GRCm39)	missense	probably benign	0.19
R5574:Sorcs1	UTSW	19	50,210,571 (GRCm39)	missense	probably damaging	1.00
R5734:Sorcs1	UTSW	19	50,171,213 (GRCm39)	missense	probably benign	0.04
R6045:Sorcs1	UTSW	19	50,178,555 (GRCm39)	nonsense	probably null
R6091:Sorcs1	UTSW	19	50,276,539 (GRCm39)	missense	possibly damaging	0.64
R6119:Sorcs1	UTSW	19	50,276,532 (GRCm39)	missense	probably damaging	0.98
R6226:Sorcs1	UTSW	19	50,169,852 (GRCm39)	missense	probably damaging	1.00
R6337:Sorcs1	UTSW	19	50,132,562 (GRCm39)	missense	probably benign	0.00
R6378:Sorcs1	UTSW	19	50,213,615 (GRCm39)	missense	possibly damaging	0.57
R6782:Sorcs1	UTSW	19	50,164,560 (GRCm39)	nonsense	probably null
R6792:Sorcs1	UTSW	19	50,666,606 (GRCm39)	missense	probably benign
R6891:Sorcs1	UTSW	19	50,213,557 (GRCm39)	nonsense	probably null
R7151:Sorcs1	UTSW	19	50,301,420 (GRCm39)	missense	probably damaging	1.00
R7223:Sorcs1	UTSW	19	50,178,480 (GRCm39)	missense	probably benign	0.06
R7356:Sorcs1	UTSW	19	50,163,595 (GRCm39)	missense	possibly damaging	0.86
R7471:Sorcs1	UTSW	19	50,250,701 (GRCm39)	missense	probably damaging	1.00
R7474:Sorcs1	UTSW	19	50,141,550 (GRCm39)	missense	possibly damaging	0.65
R7503:Sorcs1	UTSW	19	50,141,490 (GRCm39)	missense	probably benign
R7506:Sorcs1	UTSW	19	50,171,112 (GRCm39)	nonsense	probably null
R7573:Sorcs1	UTSW	19	50,141,234 (GRCm39)	nonsense	probably null
R7867:Sorcs1	UTSW	19	50,218,698 (GRCm39)	nonsense	probably null
R7911:Sorcs1	UTSW	19	50,132,470 (GRCm39)	missense	unknown
R8032:Sorcs1	UTSW	19	50,463,846 (GRCm39)	missense	probably benign	0.28
R8063:Sorcs1	UTSW	19	50,132,415 (GRCm39)	missense	unknown
R8463:Sorcs1	UTSW	19	50,248,248 (GRCm39)	missense	probably damaging	1.00
R8682:Sorcs1	UTSW	19	50,367,398 (GRCm39)	missense	probably damaging	0.99
R8724:Sorcs1	UTSW	19	50,139,658 (GRCm39)	missense	probably benign	0.33
R8926:Sorcs1	UTSW	19	50,241,096 (GRCm39)	missense	possibly damaging	0.94
R9160:Sorcs1	UTSW	19	50,213,658 (GRCm39)	missense	probably damaging	1.00
R9173:Sorcs1	UTSW	19	50,220,753 (GRCm39)	missense	possibly damaging	0.92
R9203:Sorcs1	UTSW	19	50,250,733 (GRCm39)	missense	probably damaging	1.00
R9229:Sorcs1	UTSW	19	50,141,300 (GRCm39)	missense	probably benign	0.17
R9398:Sorcs1	UTSW	19	50,213,651 (GRCm39)	missense	possibly damaging	0.90
R9430:Sorcs1	UTSW	19	50,199,208 (GRCm39)	missense	probably damaging	1.00
R9510:Sorcs1	UTSW	19	50,666,521 (GRCm39)	missense	probably benign	0.04
R9511:Sorcs1	UTSW	19	50,666,521 (GRCm39)	missense	probably benign	0.04
R9744:Sorcs1	UTSW	19	50,215,275 (GRCm39)	missense	probably damaging	1.00
R9777:Sorcs1	UTSW	19	50,248,190 (GRCm39)	critical splice donor site	probably null
X0024:Sorcs1	UTSW	19	50,171,201 (GRCm39)	missense	possibly damaging	0.92
Z1088:Sorcs1	UTSW	19	50,210,581 (GRCm39)	missense	probably benign	0.16
Z1177:Sorcs1	UTSW	19	50,322,037 (GRCm39)	missense	probably damaging	1.00
Z1177:Sorcs1	UTSW	19	50,215,180 (GRCm39)	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- ACCACAGATGCTTGCTGACATACC -3'
(R):5'- AACTTACAAGGAGGCCGTCATGC -3'

Sequencing Primer
(F):5'- GCTTGCTGACATACCTCATAAAGG -3'
(R):5'- TGCTTAACTTCCAAGGGACATGG -3'

Posted On

2013-07-11