Incidental Mutation 'R7259:Gpatch1'
ID564482
Institutional Source Beutler Lab
Gene Symbol Gpatch1
Ensembl Gene ENSMUSG00000063808
Gene NameG patch domain containing 1
SynonymsGpatc1, 1300003A17Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7259 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location35276536-35318440 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 35287121 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000078632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079693] [ENSMUST00000131143] [ENSMUST00000131213]
Predicted Effect probably null
Transcript: ENSMUST00000079693
SMART Domains Protein: ENSMUSP00000078632
Gene: ENSMUSG00000063808

DomainStartEndE-ValueType
Pfam:DUF1604 31 116 2.1e-39 PFAM
G_patch 150 191 4.72e-1 SMART
low complexity region 200 209 N/A INTRINSIC
low complexity region 456 478 N/A INTRINSIC
low complexity region 543 555 N/A INTRINSIC
low complexity region 651 665 N/A INTRINSIC
low complexity region 759 780 N/A INTRINSIC
low complexity region 803 816 N/A INTRINSIC
low complexity region 847 897 N/A INTRINSIC
low complexity region 899 909 N/A INTRINSIC
low complexity region 918 929 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131143
SMART Domains Protein: ENSMUSP00000121711
Gene: ENSMUSG00000063808

DomainStartEndE-ValueType
Pfam:DUF1604 29 98 2.2e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131213
SMART Domains Protein: ENSMUSP00000117475
Gene: ENSMUSG00000063808

DomainStartEndE-ValueType
Pfam:DUF1604 31 116 7.9e-40 PFAM
G_patch 150 191 4.72e-1 SMART
low complexity region 200 209 N/A INTRINSIC
low complexity region 456 478 N/A INTRINSIC
low complexity region 543 555 N/A INTRINSIC
low complexity region 651 665 N/A INTRINSIC
low complexity region 759 780 N/A INTRINSIC
low complexity region 803 816 N/A INTRINSIC
low complexity region 849 881 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb2 A G 13: 8,570,252 Y258C probably benign Het
Aebp2 A G 6: 140,633,768 S244G probably benign Het
Agl A T 3: 116,784,581 Y495N probably damaging Het
Arhgap33 A G 7: 30,532,200 V120A probably damaging Het
Asb14 C T 14: 26,903,455 H256Y probably benign Het
Atp2a2 A G 5: 122,466,069 Y434H probably benign Het
Atrnl1 C T 19: 57,935,606 R1268* probably null Het
Canx A G 11: 50,301,816 W324R probably damaging Het
Ccdc130 T C 8: 84,260,317 S184G probably damaging Het
Col9a1 A G 1: 24,185,343 E202G unknown Het
Crh C A 3: 19,694,254 A75S possibly damaging Het
Ctnnal1 T A 4: 56,817,299 probably null Het
Dmrta2 T A 4: 109,981,907 S284T possibly damaging Het
Dock1 T C 7: 134,782,748 V680A probably damaging Het
Duox2 G A 2: 122,295,176 R317C probably damaging Het
Elmod2 A G 8: 83,321,509 L108P probably damaging Het
Exoc6b A G 6: 84,848,810 S540P probably benign Het
Fsip2 C T 2: 82,982,130 A2931V possibly damaging Het
Gipc2 A T 3: 152,128,056 I196K probably damaging Het
Gli2 A G 1: 118,836,534 S1296P probably benign Het
Gm21103 T A 14: 6,301,894 Q173L probably damaging Het
Grm8 G A 6: 27,760,176 T385I probably null Het
Gtf2f1 C A 17: 57,004,562 D283Y probably damaging Het
Hcar1 T A 5: 123,879,212 T139S possibly damaging Het
Hcrtr1 T A 4: 130,135,818 T157S possibly damaging Het
Htra2 T G 6: 83,051,539 Q436P possibly damaging Het
Igkv1-133 A G 6: 67,725,538 D80G probably benign Het
Il21 C A 3: 37,227,654 probably null Het
Inpp5f T A 7: 128,669,957 C359S probably benign Het
Itgb6 A T 2: 60,650,011 I327N probably damaging Het
Itgbl1 A T 14: 123,843,904 T232S probably damaging Het
Kif1a T A 1: 93,073,810 K266* probably null Het
Mcm10 C A 2: 5,006,517 E214D probably benign Het
Mefv T A 16: 3,713,053 I522F probably damaging Het
Naaladl2 T A 3: 24,058,176 I581F possibly damaging Het
Naip6 A T 13: 100,304,355 Y306N probably damaging Het
Olfr1224-ps1 A C 2: 89,156,510 F222V probably benign Het
Olfr172 T C 16: 58,760,505 T224A possibly damaging Het
Olfr621-ps1 A T 7: 103,629,759 M67K probably damaging Het
Olfr780 T A 10: 129,321,794 M57K probably benign Het
Opn1sw T A 6: 29,378,912 H247L probably benign Het
Pbxip1 C A 3: 89,445,633 F195L probably benign Het
Pcdh12 A T 18: 38,281,624 F816Y probably benign Het
Pi4k2b C A 5: 52,753,245 N290K probably damaging Het
Pias2 T C 18: 77,152,720 S598P possibly damaging Het
Ppfia4 A G 1: 134,313,100 V835A probably damaging Het
Ptch1 T C 13: 63,573,294 K54E not run Het
Rnf213 A G 11: 119,452,575 I3589V Het
Scg2 T C 1: 79,436,985 Y7C probably benign Het
Sec16a A G 2: 26,441,592 V137A probably benign Het
Setdb1 G A 3: 95,339,913 T525I probably benign Het
Sgcg A T 14: 61,225,217 I227N probably benign Het
Smarca2 C T 19: 26,654,464 Q560* probably null Het
Stk10 A G 11: 32,598,497 N355S probably benign Het
Supt6 A T 11: 78,207,616 D1716E probably damaging Het
Taok3 C T 5: 117,252,543 A523V probably benign Het
Tekt3 A G 11: 63,083,766 T304A possibly damaging Het
Ttc6 G T 12: 57,576,184 R123L probably benign Het
Ulk2 A G 11: 61,782,083 L895P probably damaging Het
Unc13c A T 9: 73,517,363 N1990K probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wipf1 A G 2: 73,435,081 S393P probably damaging Het
Other mutations in Gpatch1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00818:Gpatch1 APN 7 35276813 critical splice acceptor site probably null
IGL01143:Gpatch1 APN 7 35301572 splice site probably benign
IGL01523:Gpatch1 APN 7 35308338 missense probably null 1.00
IGL01862:Gpatch1 APN 7 35295278 missense probably benign
IGL02349:Gpatch1 APN 7 35307255 missense probably damaging 1.00
IGL02792:Gpatch1 APN 7 35301593 missense probably damaging 0.96
IGL02926:Gpatch1 APN 7 35308269 missense probably damaging 1.00
IGL03099:Gpatch1 APN 7 35297523 missense possibly damaging 0.87
IGL03107:Gpatch1 APN 7 35303317 missense probably benign 0.35
IGL03324:Gpatch1 APN 7 35299280 missense probably damaging 0.96
IGL03324:Gpatch1 APN 7 35293695 missense possibly damaging 0.81
R0066:Gpatch1 UTSW 7 35287227 missense probably damaging 1.00
R0066:Gpatch1 UTSW 7 35287227 missense probably damaging 1.00
R0137:Gpatch1 UTSW 7 35287242 missense probably damaging 1.00
R0347:Gpatch1 UTSW 7 35297631 missense probably benign 0.16
R0382:Gpatch1 UTSW 7 35301655 missense probably damaging 1.00
R0390:Gpatch1 UTSW 7 35281381 intron probably benign
R0791:Gpatch1 UTSW 7 35281376 intron probably benign
R1162:Gpatch1 UTSW 7 35303480 splice site probably benign
R1374:Gpatch1 UTSW 7 35291762 missense probably damaging 1.00
R1480:Gpatch1 UTSW 7 35303338 missense probably damaging 1.00
R1556:Gpatch1 UTSW 7 35295351 missense probably benign 0.00
R1682:Gpatch1 UTSW 7 35303387 missense possibly damaging 0.80
R1887:Gpatch1 UTSW 7 35303388 missense probably damaging 0.98
R1935:Gpatch1 UTSW 7 35295522 missense probably damaging 1.00
R1936:Gpatch1 UTSW 7 35295522 missense probably damaging 1.00
R2148:Gpatch1 UTSW 7 35299276 missense probably benign 0.16
R2205:Gpatch1 UTSW 7 35291772 missense probably damaging 1.00
R2215:Gpatch1 UTSW 7 35293827 missense possibly damaging 0.48
R2274:Gpatch1 UTSW 7 35288678 missense probably benign 0.00
R2275:Gpatch1 UTSW 7 35288678 missense probably benign 0.00
R4126:Gpatch1 UTSW 7 35293654 critical splice donor site probably null
R4705:Gpatch1 UTSW 7 35299305 splice site probably null
R5227:Gpatch1 UTSW 7 35309351 missense probably benign 0.09
R5567:Gpatch1 UTSW 7 35307215 missense probably damaging 0.99
R5810:Gpatch1 UTSW 7 35295371 missense probably benign 0.01
R5946:Gpatch1 UTSW 7 35291832 missense probably damaging 0.99
R6263:Gpatch1 UTSW 7 35303423 missense probably damaging 1.00
R6386:Gpatch1 UTSW 7 35291840 missense probably damaging 1.00
R6569:Gpatch1 UTSW 7 35291738 missense probably damaging 1.00
R6847:Gpatch1 UTSW 7 35293558 intron probably null
R7186:Gpatch1 UTSW 7 35295313 missense possibly damaging 0.86
R7276:Gpatch1 UTSW 7 35297496 missense probably benign 0.00
X0020:Gpatch1 UTSW 7 35295381 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CAAGTGTCCTAGTTGAAGCTGC -3'
(R):5'- GACAAAGCTGTGGATGCAC -3'

Sequencing Primer
(F):5'- TGTCCTAGTTGAAGCTGCAAAGC -3'
(R):5'- TGTGGATGCACAGACGGAC -3'
Posted On2019-06-26