Incidental Mutation 'R7259:Dock1'
ID564485
Institutional Source Beutler Lab
Gene Symbol Dock1
Ensembl Gene ENSMUSG00000058325
Gene Namededicator of cytokinesis 1
SynonymsD630004B07Rik, Dock180, 9130006G06Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7259 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location134670654-135173639 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 134782748 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 680 (V680A)
Ref Sequence ENSEMBL: ENSMUSP00000147945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084488] [ENSMUST00000211593]
Predicted Effect probably damaging
Transcript: ENSMUST00000084488
AA Change: V680A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000081531
Gene: ENSMUSG00000058325
AA Change: V680A

DomainStartEndE-ValueType
SH3 12 69 7.57e-17 SMART
Pfam:DOCK_N 72 416 1.7e-113 PFAM
Pfam:DOCK-C2 421 618 1.2e-61 PFAM
low complexity region 628 639 N/A INTRINSIC
Pfam:DHR-2 1111 1610 3.3e-102 PFAM
low complexity region 1639 1664 N/A INTRINSIC
low complexity region 1683 1701 N/A INTRINSIC
low complexity region 1756 1773 N/A INTRINSIC
low complexity region 1823 1857 N/A INTRINSIC
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000211593
AA Change: V680A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis protein family. Dedicator of cytokinesis proteins act as guanine nucleotide exchange factors for small Rho family G proteins. The encoded protein regulates the small GTPase Rac, thereby influencing several biological processes, including phagocytosis and cell migration. Overexpression of this gene has also been associated with certain cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit postnatal lethality associated with abnormal muscle development and failure of lungs to inflate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb2 A G 13: 8,570,252 Y258C probably benign Het
Aebp2 A G 6: 140,633,768 S244G probably benign Het
Agl A T 3: 116,784,581 Y495N probably damaging Het
Arhgap33 A G 7: 30,532,200 V120A probably damaging Het
Asb14 C T 14: 26,903,455 H256Y probably benign Het
Atp2a2 A G 5: 122,466,069 Y434H probably benign Het
Atrnl1 C T 19: 57,935,606 R1268* probably null Het
Canx A G 11: 50,301,816 W324R probably damaging Het
Ccdc130 T C 8: 84,260,317 S184G probably damaging Het
Col9a1 A G 1: 24,185,343 E202G unknown Het
Crh C A 3: 19,694,254 A75S possibly damaging Het
Ctnnal1 T A 4: 56,817,299 probably null Het
Dmrta2 T A 4: 109,981,907 S284T possibly damaging Het
Duox2 G A 2: 122,295,176 R317C probably damaging Het
Elmod2 A G 8: 83,321,509 L108P probably damaging Het
Exoc6b A G 6: 84,848,810 S540P probably benign Het
Fsip2 C T 2: 82,982,130 A2931V possibly damaging Het
Gipc2 A T 3: 152,128,056 I196K probably damaging Het
Gli2 A G 1: 118,836,534 S1296P probably benign Het
Gm21103 T A 14: 6,301,894 Q173L probably damaging Het
Gpatch1 A T 7: 35,287,121 probably null Het
Grm8 G A 6: 27,760,176 T385I probably null Het
Gtf2f1 C A 17: 57,004,562 D283Y probably damaging Het
Hcar1 T A 5: 123,879,212 T139S possibly damaging Het
Hcrtr1 T A 4: 130,135,818 T157S possibly damaging Het
Htra2 T G 6: 83,051,539 Q436P possibly damaging Het
Igkv1-133 A G 6: 67,725,538 D80G probably benign Het
Il21 C A 3: 37,227,654 probably null Het
Inpp5f T A 7: 128,669,957 C359S probably benign Het
Itgb6 A T 2: 60,650,011 I327N probably damaging Het
Itgbl1 A T 14: 123,843,904 T232S probably damaging Het
Kif1a T A 1: 93,073,810 K266* probably null Het
Mcm10 C A 2: 5,006,517 E214D probably benign Het
Mefv T A 16: 3,713,053 I522F probably damaging Het
Naaladl2 T A 3: 24,058,176 I581F possibly damaging Het
Naip6 A T 13: 100,304,355 Y306N probably damaging Het
Olfr1224-ps1 A C 2: 89,156,510 F222V probably benign Het
Olfr172 T C 16: 58,760,505 T224A possibly damaging Het
Olfr621-ps1 A T 7: 103,629,759 M67K probably damaging Het
Olfr780 T A 10: 129,321,794 M57K probably benign Het
Opn1sw T A 6: 29,378,912 H247L probably benign Het
Pbxip1 C A 3: 89,445,633 F195L probably benign Het
Pcdh12 A T 18: 38,281,624 F816Y probably benign Het
Pi4k2b C A 5: 52,753,245 N290K probably damaging Het
Pias2 T C 18: 77,152,720 S598P possibly damaging Het
Ppfia4 A G 1: 134,313,100 V835A probably damaging Het
Ptch1 T C 13: 63,573,294 K54E not run Het
Rnf213 A G 11: 119,452,575 I3589V Het
Scg2 T C 1: 79,436,985 Y7C probably benign Het
Sec16a A G 2: 26,441,592 V137A probably benign Het
Setdb1 G A 3: 95,339,913 T525I probably benign Het
Sgcg A T 14: 61,225,217 I227N probably benign Het
Smarca2 C T 19: 26,654,464 Q560* probably null Het
Stk10 A G 11: 32,598,497 N355S probably benign Het
Supt6 A T 11: 78,207,616 D1716E probably damaging Het
Taok3 C T 5: 117,252,543 A523V probably benign Het
Tekt3 A G 11: 63,083,766 T304A possibly damaging Het
Ttc6 G T 12: 57,576,184 R123L probably benign Het
Ulk2 A G 11: 61,782,083 L895P probably damaging Het
Unc13c A T 9: 73,517,363 N1990K probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wipf1 A G 2: 73,435,081 S393P probably damaging Het
Other mutations in Dock1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Dock1 APN 7 135146531 splice site probably benign
IGL01319:Dock1 APN 7 134789278 missense probably benign
IGL01390:Dock1 APN 7 134745047 missense possibly damaging 0.95
IGL01394:Dock1 APN 7 134766216 missense probably benign 0.01
IGL01489:Dock1 APN 7 134999321 splice site probably benign
IGL01505:Dock1 APN 7 135158510 missense possibly damaging 0.91
IGL01586:Dock1 APN 7 134753377 missense probably damaging 1.00
IGL01637:Dock1 APN 7 135137813 critical splice acceptor site probably null
IGL01649:Dock1 APN 7 134777410 missense probably damaging 1.00
IGL01652:Dock1 APN 7 134777497 splice site probably benign
IGL01859:Dock1 APN 7 135077161 missense possibly damaging 0.51
IGL02068:Dock1 APN 7 134771548 missense probably benign 0.26
IGL02168:Dock1 APN 7 135077131 splice site probably benign
IGL02200:Dock1 APN 7 134744271 missense probably benign 0.01
IGL02244:Dock1 APN 7 134777445 nonsense probably null
IGL02285:Dock1 APN 7 135081920 critical splice donor site probably null
IGL02319:Dock1 APN 7 134772449 missense possibly damaging 0.94
IGL02334:Dock1 APN 7 135145565 missense probably damaging 1.00
IGL02338:Dock1 APN 7 135133075 missense possibly damaging 0.95
IGL02351:Dock1 APN 7 135108819 missense possibly damaging 0.51
IGL02358:Dock1 APN 7 135108819 missense possibly damaging 0.51
IGL02607:Dock1 APN 7 134851513 missense probably benign 0.13
IGL02638:Dock1 APN 7 135146480 missense probably benign 0.09
IGL02724:Dock1 APN 7 135163353 missense probably benign
IGL02820:Dock1 APN 7 135167215 missense probably benign 0.11
IGL02950:Dock1 APN 7 134730024 missense probably damaging 1.00
IGL02993:Dock1 APN 7 134744298 missense probably benign
IGL03000:Dock1 APN 7 134789240 missense probably benign 0.17
IGL03092:Dock1 APN 7 134765216 splice site probably benign
IGL03131:Dock1 APN 7 134874183 missense possibly damaging 0.80
IGL03136:Dock1 APN 7 135168389 missense probably benign 0.00
IGL03210:Dock1 APN 7 134756939 missense possibly damaging 0.62
IGL03220:Dock1 APN 7 135108522 critical splice donor site probably null
P0028:Dock1 UTSW 7 134999324 splice site probably benign
PIT4453001:Dock1 UTSW 7 135152300 missense probably benign
R0003:Dock1 UTSW 7 134730064 splice site probably benign
R0058:Dock1 UTSW 7 135108761 missense possibly damaging 0.65
R0058:Dock1 UTSW 7 135108761 missense possibly damaging 0.65
R0062:Dock1 UTSW 7 134777495 splice site probably null
R0062:Dock1 UTSW 7 134777495 splice site probably null
R0179:Dock1 UTSW 7 135098837 missense probably damaging 0.99
R0180:Dock1 UTSW 7 135098837 missense probably damaging 0.99
R0347:Dock1 UTSW 7 134763867 missense probably damaging 1.00
R0399:Dock1 UTSW 7 135163442 missense probably benign 0.00
R0457:Dock1 UTSW 7 135138145 missense possibly damaging 0.90
R0480:Dock1 UTSW 7 134737718 missense probably damaging 1.00
R0521:Dock1 UTSW 7 135143778 missense probably benign 0.21
R0792:Dock1 UTSW 7 134874150 missense probably benign 0.02
R1136:Dock1 UTSW 7 134848173 missense possibly damaging 0.95
R1224:Dock1 UTSW 7 135108819 missense possibly damaging 0.67
R1267:Dock1 UTSW 7 134746436 missense probably damaging 1.00
R1373:Dock1 UTSW 7 135167175 missense probably benign 0.01
R1401:Dock1 UTSW 7 135133936 nonsense probably null
R1454:Dock1 UTSW 7 134851609 splice site probably benign
R1465:Dock1 UTSW 7 134782409 missense probably benign 0.00
R1465:Dock1 UTSW 7 134782409 missense probably benign 0.00
R1523:Dock1 UTSW 7 134744247 missense possibly damaging 0.49
R1643:Dock1 UTSW 7 135098779 missense probably damaging 1.00
R1659:Dock1 UTSW 7 134789243 missense probably damaging 0.98
R1793:Dock1 UTSW 7 135098727 splice site probably null
R1864:Dock1 UTSW 7 135146507 missense probably benign 0.07
R1911:Dock1 UTSW 7 134999300 missense probably damaging 1.00
R2567:Dock1 UTSW 7 135145484 missense probably damaging 1.00
R3816:Dock1 UTSW 7 134744286 nonsense probably null
R3971:Dock1 UTSW 7 134746908 missense probably damaging 1.00
R4063:Dock1 UTSW 7 135115292 missense possibly damaging 0.81
R4163:Dock1 UTSW 7 134744322 missense possibly damaging 0.79
R4271:Dock1 UTSW 7 134734054 missense probably damaging 0.99
R4684:Dock1 UTSW 7 134724409 nonsense probably null
R4717:Dock1 UTSW 7 134848170 missense probably damaging 1.00
R4725:Dock1 UTSW 7 134745014 nonsense probably null
R4788:Dock1 UTSW 7 135145484 missense probably damaging 0.98
R4869:Dock1 UTSW 7 134734071 missense probably damaging 1.00
R4889:Dock1 UTSW 7 134744976 missense probably benign 0.02
R4953:Dock1 UTSW 7 135152288 missense probably benign 0.34
R5031:Dock1 UTSW 7 135152246 missense probably benign 0.02
R5161:Dock1 UTSW 7 134734062 missense possibly damaging 0.69
R5168:Dock1 UTSW 7 135118908 missense probably damaging 1.00
R5212:Dock1 UTSW 7 134789194 missense possibly damaging 0.68
R5648:Dock1 UTSW 7 134746954 missense probably damaging 1.00
R5685:Dock1 UTSW 7 134772362 missense probably benign 0.19
R5834:Dock1 UTSW 7 134763933 missense probably damaging 1.00
R6181:Dock1 UTSW 7 135158522 missense probably damaging 1.00
R6334:Dock1 UTSW 7 134851576 missense probably benign 0.01
R6406:Dock1 UTSW 7 135145486 missense probably benign 0.26
R6425:Dock1 UTSW 7 135163381 missense possibly damaging 0.79
R6489:Dock1 UTSW 7 134990541 missense probably damaging 0.99
R6616:Dock1 UTSW 7 135108492 missense possibly damaging 0.85
R6706:Dock1 UTSW 7 135133886 missense possibly damaging 0.72
R6766:Dock1 UTSW 7 134756793 intron probably null
R6861:Dock1 UTSW 7 134771478 missense probably benign 0.00
R6985:Dock1 UTSW 7 135163403 missense possibly damaging 0.95
R7285:Dock1 UTSW 7 134745008 missense probably benign 0.01
X0062:Dock1 UTSW 7 135108451 missense probably damaging 1.00
Z1088:Dock1 UTSW 7 134804547 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCCCAGTCACCTTGAAAGAGAG -3'
(R):5'- CATAGGCCAAAGTCACAGTGG -3'

Sequencing Primer
(F):5'- GTCACCTTGAAAGAGAGTCAATC -3'
(R):5'- CACAGTGGAAAATGATTGCAAACATC -3'
Posted On2019-06-26