Incidental Mutation 'R7260:Dnah14'
ID564513
Institutional Source Beutler Lab
Gene Symbol Dnah14
Ensembl Gene ENSMUSG00000047369
Gene Namedynein, axonemal, heavy chain 14
SynonymsDnahc14, Gm980, LOC381311, A230079K17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R7260 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location181576559-181815774 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 181706744 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 2320 (R2320W)
Ref Sequence ENSEMBL: ENSMUSP00000146843 (fasta)
Predicted Effect probably damaging
Transcript: ENSMUST00000208001
AA Change: R2320W

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (78/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. Two major classes of dyneins, axonemal and cytoplasmic, have been identified. DNAH14 is an axonemal dynein heavy chain (DHC) (Vaughan et al., 1996 [PubMed 8812413]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik A G 10: 28,973,886 S293P probably benign Het
Actn2 T C 13: 12,276,490 N676S probably benign Het
Amfr C T 8: 93,976,148 M463I possibly damaging Het
Ankdd1a G T 9: 65,504,552 A325D probably damaging Het
Apba2 A G 7: 64,739,745 D463G probably damaging Het
Arid5b A G 10: 68,097,807 V755A probably damaging Het
Boc A T 16: 44,490,170 F796I Het
Ccnt1 G A 15: 98,565,124 Q56* probably null Het
Cd248 T A 19: 5,069,355 Y410* probably null Het
Chd9 T A 8: 90,994,543 N986K unknown Het
Col6a6 T C 9: 105,783,969 T314A probably benign Het
Cpped1 A G 16: 11,828,463 F142L possibly damaging Het
Csmd1 C T 8: 16,000,574 A2221T probably damaging Het
Cyp2c69 C A 19: 39,842,900 V490L probably benign Het
Dcst2 T C 3: 89,366,286 F157S probably damaging Het
Ddx54 G T 5: 120,626,920 R788L probably benign Het
Dnah1 T C 14: 31,269,386 Y3145C probably damaging Het
E130309D02Rik A G 5: 143,311,839 V151A probably benign Het
Emilin2 T C 17: 71,274,790 T314A probably benign Het
Eml2 A G 7: 19,200,590 S405G probably benign Het
Ephb2 A G 4: 136,771,574 F65L probably damaging Het
Fam49b A T 15: 63,957,589 F23L possibly damaging Het
Fbn2 T C 18: 58,066,116 D1360G probably benign Het
Fbxo22 A G 9: 55,218,470 T206A probably benign Het
Filip1l A G 16: 57,570,924 E625G probably damaging Het
Gen1 A C 12: 11,256,848 M172R probably damaging Het
Gk5 A G 9: 96,119,610 K54E probably benign Het
Glis3 T C 19: 28,531,402 E394G probably benign Het
Gm16486 T C 8: 70,708,748 Y197H probably benign Het
Helq T A 5: 100,791,927 E373D probably damaging Het
Ighv1-74 A G 12: 115,802,752 F83L probably benign Het
Kdm4d T C 9: 14,463,158 D468G probably benign Het
Kif20b A G 19: 34,950,210 I957M probably damaging Het
Ldhal6b A G 17: 5,418,260 F133S possibly damaging Het
Loxhd1 T C 18: 77,332,642 Y321H possibly damaging Het
Ltbp1 A T 17: 75,066,144 M261L probably benign Het
Mical2 A T 7: 112,319,794 Q430L probably benign Het
Mroh4 A T 15: 74,608,129 N885K possibly damaging Het
Ms4a7 A G 19: 11,322,346 Y231H probably damaging Het
Msh2 G T 17: 87,717,619 V642F probably damaging Het
Muc5b G T 7: 141,842,648 A166S unknown Het
Myo18b T C 5: 112,775,288 I1868V probably benign Het
Nfatc3 T C 8: 106,108,946 S975P probably benign Het
Oacyl T C 18: 65,698,367 L25P probably damaging Het
Olfr1138 T C 2: 87,738,508 probably null Het
Olfr1145 A G 2: 87,810,387 N189S probably damaging Het
Olfr1463 T C 19: 13,235,024 F258S probably damaging Het
Olfr151 T A 9: 37,730,753 I77F probably damaging Het
Olfr816 T A 10: 129,912,287 probably benign Het
Patj A G 4: 98,416,733 I275V possibly damaging Het
Pdcd11 G A 19: 47,129,234 R1674Q possibly damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Phkb T A 8: 85,878,130 Y55N probably benign Het
Pias4 A G 10: 81,157,468 V207A possibly damaging Het
Plxna4 C A 6: 32,239,520 R540L possibly damaging Het
Psapl1 G A 5: 36,205,212 V383M probably benign Het
Rars C A 11: 35,834,454 A10S probably benign Het
Rhobtb1 A T 10: 69,270,780 K454* probably null Het
Rmnd1 A T 10: 4,414,803 probably null Het
Rnf213 A G 11: 119,452,575 I3589V Het
Rngtt T C 4: 33,356,176 S338P possibly damaging Het
Sh3bgr A G 16: 96,224,481 E189G unknown Het
Slc30a3 G A 5: 31,088,346 T281I probably damaging Het
Smok3c T A 5: 138,065,623 D457E possibly damaging Het
Stard9 C A 2: 120,706,938 Q4274K possibly damaging Het
Syne2 G T 12: 75,945,079 L1938F probably damaging Het
Tmem70 C A 1: 16,665,366 T20K possibly damaging Het
Tnrc6a A G 7: 123,186,590 E1502G probably benign Het
Tpp1 A T 7: 105,747,497 S438T probably benign Het
Tubb2a T A 13: 34,075,414 Q131L probably damaging Het
Ube2v1 A G 2: 167,629,194 S26P probably benign Het
Unc13a G T 8: 71,660,585 S207R possibly damaging Het
Usp35 T G 7: 97,320,079 D362A probably damaging Het
Utp20 A G 10: 88,751,472 I2487T probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r117 T A 17: 23,475,385 H496L probably benign Het
Vmn2r92 C T 17: 18,166,876 A159V probably damaging Het
Wdr63 T A 3: 146,046,540 M794L probably benign Het
Wiz T C 17: 32,359,111 K467E probably damaging Het
Zfp534 T C 4: 147,675,004 T403A probably benign Het
Zswim5 T C 4: 116,962,646 L416P probably damaging Het
Other mutations in Dnah14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Dnah14 APN 1 181752046 missense probably benign 0.17
IGL01764:Dnah14 APN 1 181744777 missense probably benign 0.00
IGL03218:Dnah14 APN 1 181755269 missense probably benign 0.02
IGL03290:Dnah14 APN 1 181763978 splice site probably benign
IGL03384:Dnah14 APN 1 181745949 missense probably benign 0.03
R0009:Dnah14 UTSW 1 181769407 splice site probably benign
R0125:Dnah14 UTSW 1 181752063 missense probably damaging 0.99
R0579:Dnah14 UTSW 1 181744747 missense possibly damaging 0.72
R0973:Dnah14 UTSW 1 181752145 missense probably damaging 1.00
R0973:Dnah14 UTSW 1 181752145 missense probably damaging 1.00
R0974:Dnah14 UTSW 1 181752145 missense probably damaging 1.00
R1609:Dnah14 UTSW 1 181750177 missense probably damaging 0.97
R1860:Dnah14 UTSW 1 181763960 missense probably damaging 1.00
R2050:Dnah14 UTSW 1 181752562 missense probably damaging 1.00
R2974:Dnah14 UTSW 1 181755241 critical splice acceptor site probably null
R4715:Dnah14 UTSW 1 181757223 missense probably damaging 1.00
R5076:Dnah14 UTSW 1 181757234 missense probably benign 0.01
R5424:Dnah14 UTSW 1 181763310 missense possibly damaging 0.95
R5808:Dnah14 UTSW 1 181741159 missense possibly damaging 0.72
R5997:Dnah14 UTSW 1 181770105 missense probably benign 0.00
R6052:Dnah14 UTSW 1 181666487 missense possibly damaging 0.50
R6061:Dnah14 UTSW 1 181709051 missense probably damaging 1.00
R6089:Dnah14 UTSW 1 181750154 missense probably damaging 1.00
R6092:Dnah14 UTSW 1 181621833 missense probably benign 0.13
R6145:Dnah14 UTSW 1 181666417 missense probably benign 0.00
R6163:Dnah14 UTSW 1 181666361 missense probably benign 0.33
R6246:Dnah14 UTSW 1 181680888 missense probably benign 0.00
R6302:Dnah14 UTSW 1 181601206 missense possibly damaging 0.96
R6306:Dnah14 UTSW 1 181585024 frame shift probably null
R6326:Dnah14 UTSW 1 181783556 missense probably damaging 1.00
R6348:Dnah14 UTSW 1 181626720 missense possibly damaging 0.83
R6367:Dnah14 UTSW 1 181755386 splice site probably null
R6376:Dnah14 UTSW 1 181605894 missense possibly damaging 0.79
R6389:Dnah14 UTSW 1 181651202 critical splice donor site probably null
R6433:Dnah14 UTSW 1 181651657 missense probably damaging 0.99
R6454:Dnah14 UTSW 1 181783705 missense probably damaging 1.00
R6476:Dnah14 UTSW 1 181744768 missense probably benign 0.26
R6523:Dnah14 UTSW 1 181643621 missense probably benign 0.00
R6529:Dnah14 UTSW 1 181666469 missense probably damaging 0.98
R6538:Dnah14 UTSW 1 181584985 missense unknown
R6546:Dnah14 UTSW 1 181738987 missense probably damaging 1.00
R6752:Dnah14 UTSW 1 181593452 missense probably benign 0.07
R6762:Dnah14 UTSW 1 181757259 missense probably damaging 1.00
R6786:Dnah14 UTSW 1 181641405 missense probably benign 0.21
R6849:Dnah14 UTSW 1 181808945 missense probably benign 0.00
R6877:Dnah14 UTSW 1 181628432 missense possibly damaging 0.82
R6912:Dnah14 UTSW 1 181750183 missense possibly damaging 0.83
R6919:Dnah14 UTSW 1 181585066 missense probably benign 0.04
R6924:Dnah14 UTSW 1 181627952 missense probably benign 0.04
R6957:Dnah14 UTSW 1 181785175 missense possibly damaging 0.92
R6980:Dnah14 UTSW 1 181648230 missense probably benign 0.00
R7018:Dnah14 UTSW 1 181626944 missense possibly damaging 0.55
R7046:Dnah14 UTSW 1 181623003 missense probably benign 0.01
R7058:Dnah14 UTSW 1 181698049 missense probably benign 0.00
R7068:Dnah14 UTSW 1 181769790 missense probably benign 0.35
R7115:Dnah14 UTSW 1 181720145 missense probably damaging 1.00
R7130:Dnah14 UTSW 1 181745958 nonsense probably null
R7165:Dnah14 UTSW 1 181704535 missense probably benign 0.00
R7169:Dnah14 UTSW 1 181702365 missense probably benign 0.00
R7184:Dnah14 UTSW 1 181704529 nonsense probably null
R7232:Dnah14 UTSW 1 181757363 missense probably damaging 1.00
R7276:Dnah14 UTSW 1 181685807 missense probably benign 0.41
R7290:Dnah14 UTSW 1 181628174 missense probably benign 0.20
R7326:Dnah14 UTSW 1 181598403 missense probably benign 0.02
R7336:Dnah14 UTSW 1 181797734 missense probably damaging 0.96
R7371:Dnah14 UTSW 1 181626885 missense probably benign 0.05
R7376:Dnah14 UTSW 1 181763402 missense probably benign 0.03
R7418:Dnah14 UTSW 1 181616742 missense possibly damaging 0.92
R7473:Dnah14 UTSW 1 181752139 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GATGTTAGCAGCTAGATTCATTCC -3'
(R):5'- CTTCCCACAGACTGTGTTTGAAAC -3'

Sequencing Primer
(F):5'- ACAGACTTTTACAAGGGGCTTG -3'
(R):5'- GACTGTGTTTGAAACCAACAATTCC -3'
Posted On2019-06-26