Incidental Mutation 'R7260:Myo18b'
ID564527
Institutional Source Beutler Lab
Gene Symbol Myo18b
Ensembl Gene ENSMUSG00000072720
Gene Namemyosin XVIIIb
Synonyms4932408L24Rik, 4933411E19Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7260 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location112688876-112896362 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112775288 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 1868 (I1868V)
Ref Sequence ENSEMBL: ENSMUSP00000083810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086617]
Predicted Effect probably benign
Transcript: ENSMUST00000086617
AA Change: I1868V

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000083810
Gene: ENSMUSG00000072720
AA Change: I1868V

DomainStartEndE-ValueType
low complexity region 20 28 N/A INTRINSIC
low complexity region 43 59 N/A INTRINSIC
low complexity region 86 100 N/A INTRINSIC
low complexity region 185 200 N/A INTRINSIC
low complexity region 273 290 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
low complexity region 355 372 N/A INTRINSIC
low complexity region 377 419 N/A INTRINSIC
MYSc 605 1374 8.78e-30 SMART
IQ 1375 1397 5.92e-4 SMART
Pfam:Myosin_tail_1 1423 1875 5e-12 PFAM
low complexity region 1965 1985 N/A INTRINSIC
coiled coil region 2052 2126 N/A INTRINSIC
low complexity region 2184 2199 N/A INTRINSIC
low complexity region 2325 2336 N/A INTRINSIC
low complexity region 2408 2424 N/A INTRINSIC
low complexity region 2544 2558 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may regulate muscle-specific genes when in the nucleus and may influence intracellular trafficking when in the cytoplasm. The encoded protein functions as a homodimer and may interact with F actin. Mutations in this gene are associated with lung cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis with internal hemorrhage, pericaridal effusion, enlargement of the right atrium, and cardiac myofibril abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik A G 10: 28,973,886 S293P probably benign Het
Actn2 T C 13: 12,276,490 N676S probably benign Het
Amfr C T 8: 93,976,148 M463I possibly damaging Het
Ankdd1a G T 9: 65,504,552 A325D probably damaging Het
Apba2 A G 7: 64,739,745 D463G probably damaging Het
Arid5b A G 10: 68,097,807 V755A probably damaging Het
Boc A T 16: 44,490,170 F796I Het
Ccnt1 G A 15: 98,565,124 Q56* probably null Het
Cd248 T A 19: 5,069,355 Y410* probably null Het
Chd9 T A 8: 90,994,543 N986K unknown Het
Col6a6 T C 9: 105,783,969 T314A probably benign Het
Cpped1 A G 16: 11,828,463 F142L possibly damaging Het
Csmd1 C T 8: 16,000,574 A2221T probably damaging Het
Cyp2c69 C A 19: 39,842,900 V490L probably benign Het
Dcst2 T C 3: 89,366,286 F157S probably damaging Het
Ddx54 G T 5: 120,626,920 R788L probably benign Het
Dnah1 T C 14: 31,269,386 Y3145C probably damaging Het
Dnah14 A T 1: 181,706,744 R2320W probably damaging Het
E130309D02Rik A G 5: 143,311,839 V151A probably benign Het
Emilin2 T C 17: 71,274,790 T314A probably benign Het
Eml2 A G 7: 19,200,590 S405G probably benign Het
Ephb2 A G 4: 136,771,574 F65L probably damaging Het
Fam49b A T 15: 63,957,589 F23L possibly damaging Het
Fbn2 T C 18: 58,066,116 D1360G probably benign Het
Fbxo22 A G 9: 55,218,470 T206A probably benign Het
Filip1l A G 16: 57,570,924 E625G probably damaging Het
Gen1 A C 12: 11,256,848 M172R probably damaging Het
Gk5 A G 9: 96,119,610 K54E probably benign Het
Glis3 T C 19: 28,531,402 E394G probably benign Het
Gm16486 T C 8: 70,708,748 Y197H probably benign Het
Helq T A 5: 100,791,927 E373D probably damaging Het
Ighv1-74 A G 12: 115,802,752 F83L probably benign Het
Kdm4d T C 9: 14,463,158 D468G probably benign Het
Kif20b A G 19: 34,950,210 I957M probably damaging Het
Ldhal6b A G 17: 5,418,260 F133S possibly damaging Het
Loxhd1 T C 18: 77,332,642 Y321H possibly damaging Het
Ltbp1 A T 17: 75,066,144 M261L probably benign Het
Mical2 A T 7: 112,319,794 Q430L probably benign Het
Mroh4 A T 15: 74,608,129 N885K possibly damaging Het
Ms4a7 A G 19: 11,322,346 Y231H probably damaging Het
Msh2 G T 17: 87,717,619 V642F probably damaging Het
Muc5b G T 7: 141,842,648 A166S unknown Het
Nfatc3 T C 8: 106,108,946 S975P probably benign Het
Oacyl T C 18: 65,698,367 L25P probably damaging Het
Olfr1145 A G 2: 87,810,387 N189S probably damaging Het
Olfr1463 T C 19: 13,235,024 F258S probably damaging Het
Olfr151 T A 9: 37,730,753 I77F probably damaging Het
Olfr816 T A 10: 129,912,287 probably benign Het
Patj A G 4: 98,416,733 I275V possibly damaging Het
Pdcd11 G A 19: 47,129,234 R1674Q possibly damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Phkb T A 8: 85,878,130 Y55N probably benign Het
Pias4 A G 10: 81,157,468 V207A possibly damaging Het
Plxna4 C A 6: 32,239,520 R540L possibly damaging Het
Psapl1 G A 5: 36,205,212 V383M probably benign Het
Rars C A 11: 35,834,454 A10S probably benign Het
Rhobtb1 A T 10: 69,270,780 K454* probably null Het
Rnf213 A G 11: 119,452,575 I3589V Het
Rngtt T C 4: 33,356,176 S338P possibly damaging Het
Sh3bgr A G 16: 96,224,481 E189G unknown Het
Slc30a3 G A 5: 31,088,346 T281I probably damaging Het
Smok3c T A 5: 138,065,623 D457E possibly damaging Het
Stard9 C A 2: 120,706,938 Q4274K possibly damaging Het
Syne2 G T 12: 75,945,079 L1938F probably damaging Het
Tmem70 C A 1: 16,665,366 T20K possibly damaging Het
Tnrc6a A G 7: 123,186,590 E1502G probably benign Het
Tpp1 A T 7: 105,747,497 S438T probably benign Het
Tubb2a T A 13: 34,075,414 Q131L probably damaging Het
Ube2v1 A G 2: 167,629,194 S26P probably benign Het
Unc13a G T 8: 71,660,585 S207R possibly damaging Het
Usp35 T G 7: 97,320,079 D362A probably damaging Het
Utp20 A G 10: 88,751,472 I2487T probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r117 T A 17: 23,475,385 H496L probably benign Het
Vmn2r92 C T 17: 18,166,876 A159V probably damaging Het
Wdr63 T A 3: 146,046,540 M794L probably benign Het
Wiz T C 17: 32,359,111 K467E probably damaging Het
Zfp534 T C 4: 147,675,004 T403A probably benign Het
Zswim5 T C 4: 116,962,646 L416P probably damaging Het
Other mutations in Myo18b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Myo18b APN 5 112874131 missense probably benign 0.05
IGL00847:Myo18b APN 5 112830389 splice site probably benign
IGL00848:Myo18b APN 5 112871485 missense probably damaging 1.00
IGL00969:Myo18b APN 5 112875007 unclassified probably benign
IGL01018:Myo18b APN 5 112809747 missense probably damaging 1.00
IGL01448:Myo18b APN 5 112811704 missense probably damaging 1.00
IGL01490:Myo18b APN 5 112809700 missense possibly damaging 0.84
IGL01556:Myo18b APN 5 112757449 splice site probably benign
IGL01637:Myo18b APN 5 112840629 missense possibly damaging 0.82
IGL01819:Myo18b APN 5 112878050 missense unknown
IGL02007:Myo18b APN 5 112874972 unclassified probably benign
IGL02146:Myo18b APN 5 112843285 missense probably damaging 1.00
IGL02229:Myo18b APN 5 112878110 missense unknown
IGL02319:Myo18b APN 5 112791139 missense probably damaging 0.99
IGL02398:Myo18b APN 5 112830312 missense possibly damaging 0.92
IGL02420:Myo18b APN 5 112827986 missense possibly damaging 0.64
IGL02626:Myo18b APN 5 112878085 missense unknown
IGL02815:Myo18b APN 5 112809735 missense probably damaging 1.00
IGL02822:Myo18b APN 5 112775345 missense probably damaging 1.00
IGL02852:Myo18b APN 5 112715511 missense probably benign 0.03
IGL02995:Myo18b APN 5 112775413 splice site probably benign
IGL03019:Myo18b APN 5 112692397 missense probably benign 0.21
IGL03039:Myo18b APN 5 112840771 missense probably damaging 1.00
IGL03112:Myo18b APN 5 112873990 missense probably benign 0.02
IGL03123:Myo18b APN 5 112874938 unclassified probably benign
IGL03288:Myo18b APN 5 112789997 missense probably damaging 1.00
IGL03391:Myo18b APN 5 112874479 unclassified probably benign
PIT4651001:Myo18b UTSW 5 112834435 missense probably benign 0.01
R0271:Myo18b UTSW 5 112809685 missense possibly damaging 0.91
R0277:Myo18b UTSW 5 112693347 splice site probably benign
R0352:Myo18b UTSW 5 112874523 unclassified probably benign
R0504:Myo18b UTSW 5 112873576 unclassified probably benign
R0539:Myo18b UTSW 5 112723868 missense probably damaging 0.99
R0599:Myo18b UTSW 5 112865750 missense probably damaging 1.00
R0627:Myo18b UTSW 5 112798834 missense probably benign 0.38
R0659:Myo18b UTSW 5 112760327 missense possibly damaging 0.66
R0671:Myo18b UTSW 5 112692766 missense probably benign 0.00
R0847:Myo18b UTSW 5 112874488 unclassified probably benign
R1082:Myo18b UTSW 5 112760414 missense probably damaging 1.00
R1116:Myo18b UTSW 5 112803279 missense probably damaging 1.00
R1264:Myo18b UTSW 5 112830319 missense probably benign 0.12
R1280:Myo18b UTSW 5 112723805 critical splice donor site probably null
R1444:Myo18b UTSW 5 112775251 critical splice donor site probably null
R1446:Myo18b UTSW 5 112757559 missense probably damaging 1.00
R1470:Myo18b UTSW 5 112693033 missense probably damaging 1.00
R1470:Myo18b UTSW 5 112693033 missense probably damaging 1.00
R1590:Myo18b UTSW 5 112875266 nonsense probably null
R1601:Myo18b UTSW 5 112871498 missense possibly damaging 0.73
R1903:Myo18b UTSW 5 112692758 missense probably damaging 1.00
R1935:Myo18b UTSW 5 112760356 missense probably benign 0.04
R1936:Myo18b UTSW 5 112760356 missense probably benign 0.04
R2008:Myo18b UTSW 5 112873557 missense probably benign
R2127:Myo18b UTSW 5 112831078 missense probably damaging 1.00
R2129:Myo18b UTSW 5 112831078 missense probably damaging 1.00
R2141:Myo18b UTSW 5 112874026 missense probably benign 0.01
R2170:Myo18b UTSW 5 112723858 missense probably benign 0.23
R2258:Myo18b UTSW 5 112874663 unclassified probably benign
R2265:Myo18b UTSW 5 112782673 missense probably damaging 1.00
R2483:Myo18b UTSW 5 112858408 missense probably damaging 1.00
R2931:Myo18b UTSW 5 112693127 missense probably benign 0.01
R3160:Myo18b UTSW 5 112692728 missense probably damaging 0.99
R3162:Myo18b UTSW 5 112692728 missense probably damaging 0.99
R3777:Myo18b UTSW 5 112757596 missense probably damaging 0.99
R4240:Myo18b UTSW 5 112803187 critical splice donor site probably null
R4243:Myo18b UTSW 5 112692395 missense possibly damaging 0.95
R4245:Myo18b UTSW 5 112692395 missense possibly damaging 0.95
R4533:Myo18b UTSW 5 112693025 missense probably damaging 1.00
R4631:Myo18b UTSW 5 112846400 missense probably damaging 1.00
R4661:Myo18b UTSW 5 112875175 unclassified probably benign
R4755:Myo18b UTSW 5 112874474 nonsense probably null
R4771:Myo18b UTSW 5 112692227 nonsense probably null
R4812:Myo18b UTSW 5 112809718 missense possibly damaging 0.95
R4840:Myo18b UTSW 5 112874029 missense probably benign 0.02
R4888:Myo18b UTSW 5 112874480 unclassified probably benign
R4995:Myo18b UTSW 5 112760392 missense probably damaging 0.99
R5001:Myo18b UTSW 5 112761340 missense probably damaging 0.99
R5015:Myo18b UTSW 5 112790057 missense probably damaging 1.00
R5055:Myo18b UTSW 5 112875217 unclassified probably benign
R5070:Myo18b UTSW 5 112761346 missense probably damaging 1.00
R5105:Myo18b UTSW 5 112840778 missense probably damaging 1.00
R5121:Myo18b UTSW 5 112874480 unclassified probably benign
R5130:Myo18b UTSW 5 112873903 missense probably benign 0.06
R5186:Myo18b UTSW 5 112871470 missense probably damaging 1.00
R5437:Myo18b UTSW 5 112757573 missense possibly damaging 0.73
R5535:Myo18b UTSW 5 112790042 missense probably damaging 1.00
R5560:Myo18b UTSW 5 112868295 missense probably damaging 0.96
R5810:Myo18b UTSW 5 112834450 missense probably damaging 1.00
R5898:Myo18b UTSW 5 112802330 intron probably null
R6065:Myo18b UTSW 5 112692781 missense probably benign 0.00
R6104:Myo18b UTSW 5 112874291 unclassified probably benign
R6113:Myo18b UTSW 5 112866385 missense probably damaging 1.00
R6158:Myo18b UTSW 5 112874172 missense probably benign 0.01
R6167:Myo18b UTSW 5 112872507 splice site probably null
R6220:Myo18b UTSW 5 112757507 missense possibly damaging 0.93
R6276:Myo18b UTSW 5 112811642 missense probably benign 0.31
R6290:Myo18b UTSW 5 112865735 missense possibly damaging 0.69
R6291:Myo18b UTSW 5 112865735 missense possibly damaging 0.69
R6795:Myo18b UTSW 5 112846364 missense probably damaging 0.99
R6798:Myo18b UTSW 5 112761386 missense probably damaging 0.98
R6817:Myo18b UTSW 5 112830238 missense probably benign 0.00
R6937:Myo18b UTSW 5 112802392 missense probably benign 0.12
R7034:Myo18b UTSW 5 112723904 nonsense probably null
R7097:Myo18b UTSW 5 112874405 missense unknown
R7145:Myo18b UTSW 5 112817679 nonsense probably null
R7201:Myo18b UTSW 5 112715459 missense probably damaging 1.00
R7265:Myo18b UTSW 5 112812072 missense probably damaging 1.00
Z1088:Myo18b UTSW 5 112692943 missense possibly damaging 0.89
Z1088:Myo18b UTSW 5 112757484 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- AGACATAATCTGCTCATGCCC -3'
(R):5'- TTTCAAAGAACCTTGGTCCTGG -3'

Sequencing Primer
(F):5'- GCTCCACCCAACAGAGGTGAG -3'
(R):5'- AACCTTGGTCCTGGCCGTG -3'
Posted On2019-06-26