Incidental Mutation 'R7260:Arid5b'
ID564554
Institutional Source Beutler Lab
Gene Symbol Arid5b
Ensembl Gene ENSMUSG00000019947
Gene NameAT rich interactive domain 5B (MRF1-like)
Synonyms5430435G07Rik, Mrf2beta, Mrf2alpha, Mrf2, Desrt
MMRRC Submission
Accession Numbers

Genbank: NM_023598; MGI: 2175912

Is this an essential gene? Probably essential (E-score: 0.852) question?
Stock #R7260 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location68092520-68278740 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 68097807 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 755 (V755A)
Ref Sequence ENSEMBL: ENSMUSP00000151227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020106] [ENSMUST00000218532] [ENSMUST00000219238]
Predicted Effect probably benign
Transcript: ENSMUST00000020106
SMART Domains Protein: ENSMUSP00000020106
Gene: ENSMUSG00000019947

DomainStartEndE-ValueType
ARID 316 407 8.29e-35 SMART
BRIGHT 320 412 4.18e-38 SMART
low complexity region 425 438 N/A INTRINSIC
low complexity region 451 462 N/A INTRINSIC
low complexity region 538 549 N/A INTRINSIC
low complexity region 695 718 N/A INTRINSIC
low complexity region 730 741 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000218532
AA Change: V512A

PolyPhen 2 Score 0.493 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect probably damaging
Transcript: ENSMUST00000219238
AA Change: V755A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (78/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AT-rich interaction domain (ARID) family of DNA binding proteins. The encoded protein forms a histone H3K9Me2 demethylase complex with PHD finger protein 2 and regulates the transcription of target genes involved in adipogenesis and liver development. This gene also plays a role in cell growth and differentiation of B-lymphocyte progenitors, and single nucleotide polymorphisms in this gene are associated with acute lymphoblastic leukemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene experience a high level of mortality perinatally or earlier. Growth rates are low and mice remain small throughout live. There are abnormalities in various organ systems as well as the reproductive system. Fertility is reduced. [provided by MGI curators]
Allele List at MGI

All alleles(212) : Targeted, knock-out(2) Gene trapped(210)

Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik A G 10: 28,973,886 S293P probably benign Het
Actn2 T C 13: 12,276,490 N676S probably benign Het
Amfr C T 8: 93,976,148 M463I possibly damaging Het
Ankdd1a G T 9: 65,504,552 A325D probably damaging Het
Apba2 A G 7: 64,739,745 D463G probably damaging Het
Boc A T 16: 44,490,170 F796I Het
Ccnt1 G A 15: 98,565,124 Q56* probably null Het
Cd248 T A 19: 5,069,355 Y410* probably null Het
Chd9 T A 8: 90,994,543 N986K unknown Het
Col6a6 T C 9: 105,783,969 T314A probably benign Het
Cpped1 A G 16: 11,828,463 F142L possibly damaging Het
Csmd1 C T 8: 16,000,574 A2221T probably damaging Het
Cyp2c69 C A 19: 39,842,900 V490L probably benign Het
Dcst2 T C 3: 89,366,286 F157S probably damaging Het
Ddx54 G T 5: 120,626,920 R788L probably benign Het
Dnah1 T C 14: 31,269,386 Y3145C probably damaging Het
Dnah14 A T 1: 181,706,744 R2320W probably damaging Het
E130309D02Rik A G 5: 143,311,839 V151A probably benign Het
Emilin2 T C 17: 71,274,790 T314A probably benign Het
Eml2 A G 7: 19,200,590 S405G probably benign Het
Ephb2 A G 4: 136,771,574 F65L probably damaging Het
Fam49b A T 15: 63,957,589 F23L possibly damaging Het
Fbn2 T C 18: 58,066,116 D1360G probably benign Het
Fbxo22 A G 9: 55,218,470 T206A probably benign Het
Filip1l A G 16: 57,570,924 E625G probably damaging Het
Gen1 A C 12: 11,256,848 M172R probably damaging Het
Gk5 A G 9: 96,119,610 K54E probably benign Het
Glis3 T C 19: 28,531,402 E394G probably benign Het
Gm16486 T C 8: 70,708,748 Y197H probably benign Het
Helq T A 5: 100,791,927 E373D probably damaging Het
Ighv1-74 A G 12: 115,802,752 F83L probably benign Het
Kdm4d T C 9: 14,463,158 D468G probably benign Het
Kif20b A G 19: 34,950,210 I957M probably damaging Het
Ldhal6b A G 17: 5,418,260 F133S possibly damaging Het
Loxhd1 T C 18: 77,332,642 Y321H possibly damaging Het
Ltbp1 A T 17: 75,066,144 M261L probably benign Het
Mical2 A T 7: 112,319,794 Q430L probably benign Het
Mroh4 A T 15: 74,608,129 N885K possibly damaging Het
Ms4a7 A G 19: 11,322,346 Y231H probably damaging Het
Msh2 G T 17: 87,717,619 V642F probably damaging Het
Muc5b G T 7: 141,842,648 A166S unknown Het
Myo18b T C 5: 112,775,288 I1868V probably benign Het
Nfatc3 T C 8: 106,108,946 S975P probably benign Het
Oacyl T C 18: 65,698,367 L25P probably damaging Het
Olfr1138 T C 2: 87,738,508 probably null Het
Olfr1145 A G 2: 87,810,387 N189S probably damaging Het
Olfr1463 T C 19: 13,235,024 F258S probably damaging Het
Olfr151 T A 9: 37,730,753 I77F probably damaging Het
Olfr816 T A 10: 129,912,287 probably benign Het
Patj A G 4: 98,416,733 I275V possibly damaging Het
Pdcd11 G A 19: 47,129,234 R1674Q possibly damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Phkb T A 8: 85,878,130 Y55N probably benign Het
Pias4 A G 10: 81,157,468 V207A possibly damaging Het
Plxna4 C A 6: 32,239,520 R540L possibly damaging Het
Psapl1 G A 5: 36,205,212 V383M probably benign Het
Rars C A 11: 35,834,454 A10S probably benign Het
Rhobtb1 A T 10: 69,270,780 K454* probably null Het
Rmnd1 A T 10: 4,414,803 probably null Het
Rnf213 A G 11: 119,452,575 I3589V Het
Rngtt T C 4: 33,356,176 S338P possibly damaging Het
Sh3bgr A G 16: 96,224,481 E189G unknown Het
Slc30a3 G A 5: 31,088,346 T281I probably damaging Het
Smok3c T A 5: 138,065,623 D457E possibly damaging Het
Stard9 C A 2: 120,706,938 Q4274K possibly damaging Het
Syne2 G T 12: 75,945,079 L1938F probably damaging Het
Tmem70 C A 1: 16,665,366 T20K possibly damaging Het
Tnrc6a A G 7: 123,186,590 E1502G probably benign Het
Tpp1 A T 7: 105,747,497 S438T probably benign Het
Tubb2a T A 13: 34,075,414 Q131L probably damaging Het
Ube2v1 A G 2: 167,629,194 S26P probably benign Het
Unc13a G T 8: 71,660,585 S207R possibly damaging Het
Usp35 T G 7: 97,320,079 D362A probably damaging Het
Utp20 A G 10: 88,751,472 I2487T probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r117 T A 17: 23,475,385 H496L probably benign Het
Vmn2r92 C T 17: 18,166,876 A159V probably damaging Het
Wdr63 T A 3: 146,046,540 M794L probably benign Het
Wiz T C 17: 32,359,111 K467E probably damaging Het
Zfp534 T C 4: 147,675,004 T403A probably benign Het
Zswim5 T C 4: 116,962,646 L416P probably damaging Het
Other mutations in Arid5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Arid5b APN 10 68128975 missense probably damaging 0.96
IGL01731:Arid5b APN 10 68097609 missense probably damaging 1.00
IGL02069:Arid5b APN 10 68097399 missense probably damaging 1.00
IGL02161:Arid5b APN 10 68096668 missense probably benign 0.00
IGL02555:Arid5b APN 10 68101904 missense probably benign 0.01
IGL02873:Arid5b APN 10 68101950 missense probably benign 0.06
IGL03119:Arid5b APN 10 68243227 missense probably damaging 1.00
IGL03271:Arid5b APN 10 68097457 missense possibly damaging 0.73
3-1:Arid5b UTSW 10 68098589 missense probably damaging 1.00
PIT4677001:Arid5b UTSW 10 68098011 missense probably damaging 0.99
R0108:Arid5b UTSW 10 68278729 utr 5 prime probably benign
R0525:Arid5b UTSW 10 68097846 missense possibly damaging 0.90
R0533:Arid5b UTSW 10 68186033 missense probably damaging 1.00
R0646:Arid5b UTSW 10 68096977 missense probably damaging 1.00
R1066:Arid5b UTSW 10 68098356 missense probably benign 0.04
R1487:Arid5b UTSW 10 68097214 nonsense probably null
R1638:Arid5b UTSW 10 68277947 missense possibly damaging 0.48
R1789:Arid5b UTSW 10 68186067 missense probably damaging 0.99
R2031:Arid5b UTSW 10 68278688 critical splice donor site probably null
R2337:Arid5b UTSW 10 68097777 missense possibly damaging 0.63
R2996:Arid5b UTSW 10 68098462 missense probably benign 0.01
R2997:Arid5b UTSW 10 68098462 missense probably benign 0.01
R3547:Arid5b UTSW 10 68098462 missense probably benign 0.01
R4411:Arid5b UTSW 10 68096689 missense probably damaging 1.00
R4860:Arid5b UTSW 10 68243095 missense probably damaging 0.97
R4860:Arid5b UTSW 10 68243095 missense probably damaging 0.97
R5219:Arid5b UTSW 10 68278110 missense probably benign 0.08
R5341:Arid5b UTSW 10 68278127 missense possibly damaging 0.87
R5434:Arid5b UTSW 10 68096889 missense possibly damaging 0.67
R5757:Arid5b UTSW 10 68102079 missense probably damaging 1.00
R6114:Arid5b UTSW 10 68097744 missense possibly damaging 0.89
R6313:Arid5b UTSW 10 68097582 missense possibly damaging 0.95
R6338:Arid5b UTSW 10 68098561 nonsense probably null
R6525:Arid5b UTSW 10 68097666 missense possibly damaging 0.47
R6915:Arid5b UTSW 10 68186212 nonsense probably null
R7013:Arid5b UTSW 10 68097819 missense probably damaging 1.00
R7099:Arid5b UTSW 10 68098179 missense probably damaging 1.00
R7324:Arid5b UTSW 10 68128922 missense probably benign 0.44
R7334:Arid5b UTSW 10 68243177 missense possibly damaging 0.61
R7432:Arid5b UTSW 10 68118266 missense probably damaging 1.00
R7453:Arid5b UTSW 10 68243164 missense probably benign 0.01
X0066:Arid5b UTSW 10 68118302 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACGGCTCTCTTCTCTAACAG -3'
(R):5'- TCATGTCCCCATTGGCTAAG -3'

Sequencing Primer
(F):5'- AACAGTTTATCTTTGCCCTCCTGTG -3'
(R):5'- TGTCCCCATTGGCTAAGAAAAAG -3'
Posted On2019-06-26